top of page

Fly Ball Catch 2

Writer: Nate Serg
Nate Serg
Apr 30, 2021
94 min read

Updated: May 9, 2021

SARS-COV-1 and Coronavirus PAPERS:



J.S.M. PEIRIS 2003 SARS-COV-1 PAPER: On November 16, 2002, the first case of atypical pneumonia was reported in Guangdong province in the southern part of China. It wasn't until nearly 4 months later on March 12th, 2003 that the WHO announced a global alert about a severe pneumonia affecting parts of Asia. On March 24th, 2003, a CDC laboratory analysis suggested that this "new" respiratory disease was caused by a "Coronavirus." On April 16th, 2003, 5 months after the first reported case of this atypical pneumonia in China, the WHO issued a press release stating that "SARS-COV-1" was the official cause of SARS. Below are highlights one of the papers cited as evidence for this new "Coronavirus:" CORONAVIRUS AS A POSSIBLE CAUSE OF SEVERE ACUTE RESPIRATORY SYNDROME "We collected nasopharyngeal aspirates and serum samples from all patients. Paired acute and convalescent sera and faeces were available from some patients. A LUNG-BIOPSY TISSUE SAMPLE FROM ONE PATIENT WAS PROCESSED FOR VIRAL CULTURE AND REVERSE-TRANSCRIPTASE PCR (RT-PCR) and for routine histopathological examination and electron microscopy. WE USED AS CONTROLS nasopharyngeal aspirates, and faeces and sera submitted for microbiological investigation OF OTHER DISEASES from patients whose identities were masked." "The nasopharyngeal aspirate was assessed by rapid immunofluorescence antigen detection for influenza A and B, parainfluenza types 1, 2, and 3, respiratory syncytial virus and adenovirus,3 AND WAS CULTURED FOR CONVENTIONAL RESPIRATORY PATHOGENS on Mardin Darby Canine Kidney, LLC-Mk2, RDE, Hep-2 and MRC-5 cells.4 Subsequently, fetal rhesus kidney (FRhK-4) and A-549 cells were added to the panel of cell lines used." "AFTER CULTURE AND GENETIC SEQUENCING OF A CORONAVIRUS FROM TWO PATIENTS, we developed an RT-PCR to detect the coronavirus sequence from nasopharyngeal aspiration samples." "CORONAVIRUS-INFECTED FETAL RHESUS KIDNEY CELLS were fixed in acetone and used in an indirect immunofluorescence assay TO DETECT A SEROLOGICAL RESPONSE TO THE VIRUS." "Random RT-PCR assay TO FIND OUT THE GENETIC SEQUENCE INFORMATION OF AN UNKNOWN RNA VIRUS, WE DID A RANDOM RT-PCR ASSAY. Total RNA from virus-infected and virus-uninfected fetal rhesus kidney cells were isolated. The RNA samples were reverse transcribed with primer 5--GCCGGAGCTCTGCAGAATTCNNNNNN-3-, where N=A, T, C, or G, and cDNA was amplified by a primer 5--GCCGGAGCTCTGCAGAATTC-3-. Unique PCR products (in size) in the infected cell preparation were cloned and sequenced, and the GENETIC HOMOLOGY COMPARED WITH THOSE IN GENBANK." "Routine microbiological investigation for known viruses and bacteria by culture, antigen detection, and PCR was negative IN MOST CASES. Blood culture was positive for ESCHERICHIA COLI in one man aged 74 years admitted to intensive care. The finding was attributed to a hospital-acquired urinary-tract infection. KLEBSIELLA PNEUMONIAE AND HAEMOPHILUS INFLUENZA WERE ISOLATED FROM THE SPUTUM SAMPLES OF TWO OTHER PATIENTS ON ADMISSION." VIRUSES WERE ISOLATED ON FETAL RHESUS KIDNEY CELLS FROM THE LUNG BIOPSY AND NASOPHARYNGEAL ASPIRATE, RESPECTIVELY, OF THESE TWO PATIENTS. The initial cytopathic effect noted was the appearance of rounded refractile cells appearing 2–4 days after inoculation. THE CYTOPATHIC EFFECT DID NOT PROGRESS IN THE INITIAL CULTURE TUBES BUT ON SUBSEQUENT PASSAGE, and appeared in 24 h. The two virus isolates did not react with the routine panel of reagents used to identify virus isolates, including those to influenza A, B, parainfluenza types 1, 2, and 3, adenovirus, and respiratory syncytial virus (DAKO, Glostrup, Denmark). They also did not react in RT-PCR assays for influenza A and human metapneumovirus, or in PCR assays for mycoplasma. The virus was ether sensitive, which shows that it was an enveloped virus. ELECTRON MICROSCOPY OF NEGATIVE STAINED (3% potassium phospho-tungstate, pH 7·0) ultracentrifuged CELL-CULTURE EXTRACTS showed the presence of pleomorphic enveloped virus particles of around 80–90 nm (range 70–130 nm) in diameter with surface morphology compatible with a coronavirus (figure 1). Thin-section electron microscopy of infected cells revealed virus particles of 55–90 nm diameter within smooth walled vesicles in the cytoplasm (figure 2, B). Virus particles were also seen at the cell surface. The overall findings were compatible with coronavirus infection in the cells. A thin-section electron micrograph of the lung biopsy sample from the 53-year-old male contained 60–90 nm viral particles in the cytoplasm of desquamated cells. THESE VIRAL PARTICLES WERE SIMILAR IN SIZE AND MORPHOLOGIC TO THOSE OBSERVED IN THE CELL CULTURED VIRUS ISOLATES FROM BOTH PATIENTS (figure 2, A). "The RT-PCR PRODUCTS GENERATED IN A RANDOM PRIMER RT-PCR ASSAY were analysed, and unique bands found in the virus-infected samples were cloned and sequenced. Of 30 clones examined, ONE CONTAINING 646 bp OF UNKNOWN ORIGIN WAS IDENTIFIED. Sequence analysis of this DNA fragment SUGGESTED THIS SEQUENCE HAD A WEAK HOMOLOGY TO VIRUSES OF THE FAMILY OF CORONAVIRIDAE. DEDUCED AMINOACID SEQUENCE (215 amino acids) from this unknown sequence, however, HAD THE HIGHEST HOMOLOGY (57%) TO THE RNA POLYMERASE OF BOVINE CORONAVIRUS AND MURINE HEPATITIS VIRUS, confirming that this virus belongs to the family of Coronaviridae. Phylogenetic analysis of the protein sequences showed that this virus, although most closely related to the group II coronaviruses, was a distinct virus (figure 3). BASED ON THE 646 bp SEQUENCE OF THE ISOLATE, SPECIFIC PRIMERS FOR DETECTING THE NEW VIRUS WERE DESIGNED FOR RT-PCR DETECTION of this human pneumonia-associated coronavirus genome in clinical samples. OF THE 44 NASOPHARYNGEAL SAMPLES AVAILABLE FROM THE 50 SARS PATIENTS, 22 HAD EVIDENCE OF HUMAN PNEUMONIA-ASSOCIATED CORONAVIRUS RNA. Viral RNA was detectable in ten of 18 faecal samples tested. The specificity of the RT-PCR reaction was confirmed by sequencing selected positive RT-PCR-amplified products. None of 40 nasopharyngeal and faecal samples from patients with unrelated diseases were reactive on RT-PCR." "IF SEROPOSITIVITY TO HUMAN PNEUMONIA-ASSOCIATED CORONAVIRUS IN ONE SERUM SAMPLE OR VIRAL RNA DETECTION IN THE NASOPHARYNGEAL ASPIRATES OR STOOLS IS DEEMED EVIDENCE OF INFECTION WITH THE CORONAVIRUS, 45 of the 50 patients have evidence of infection. Of the five patients with no virological evidence of coronavirus infection, only one had a serum sample tested more than 14 days after onset of clinical disease." "Discussion The outbreak of SARS is unusual in several ways, especially in the appearance of clusters of patients with pneumonia in health-care workers and family contacts. In this series of patients, investigations for conventional pathogens of atypical pneumonia proved negative. However, a virus belonging to the family Coronaviridae was isolated from the lung biopsy and nasopharyngeal aspirate of TWO SARS PATIENTS and other patients with SARS had a SEROLOGICAL RESPONSE to this virus." "Phylogenetically, human pneumonia-associated coronavirus was not closely related to any known human or animal coronavirus or torovirus. WE BASED OUR ANALYSIS ON A 646 bp FRAGMENT OF THE POLYMERASE GENE which showed that the virus belongs to antigenic group 2 of the coronaviruses, along with murine hepatitis virus and bovine coronavirus." "MOST PATIENTS who had clinically defined SARS had EITHER SEROLOGICAL OR RT-PCR EVIDENCE OF INFECTION by this virus." "No evidence of human-metapneumovirus infection, by RT-PCR or rising antibody titre, was detected in any of our patients and no other pathogen was CONSISTENTLY detected. IT IS THEREFORE HIGHLY LIKELY THAT THIS CORONAVIRUS IS EITHER THE CAUSE OF SARS OR A NECESSARY PREREQUISITE FOR DISEASE PROGRESSION. WHETHER OTHER MICROBIAL OR NON-MICROBIAL COFACTORS PLAY A PART IN PROGRESSION OF THE DISEASES REMAINS TO BE INVESTIGATED." "The EPIDEMIOLOGICAL DATA at present SEEM TO SUGGEST that the virus is spread by droplets or by direct and indirect contact, although airborne spread cannot be ruled out. The finding of infectious virus in the respiratory tract supports this contention. Preliminary evidence also suggests that the virus may be shed in the faeces. HOWEVER, DETECTION OF VIRAL RNA DOES NOT PROVE THAT THE VIRUS IS VIABLE OR TRANSMISSIBLE. If a viable virus is detectable in the faeces, this is potentially an additional route of transmission." "We have provided evidence that a virus in the coronavirus family is the causal agent of SARS. HOWEVER IT REMAINS POSSIBLE THAT OTHER VIRUSES ACT AS OPPORTUNISTIC SECONDARY INVADERS TO INCREASE THE DISEASE PROGRESSION, A HYPOTHESIS THAT NEEDS TO BE INVESTIGATED FURTHER." doi: 10.1016/s0140-6736(03)13077-2. In Summary: -a lung biopsy was only carried out on one patient -they used samples from patients with OTHER DISEASES as a control -they used numerous cell lines (Mardin Darby Canine Kidney, LLC-Mk2, RDE, Hep-2 and MRC-5 cells as well as fetal rhesus monkey and A-549 cells) to culture respiratory "viruses" -after cell cultures and genetic sequences from TWO patients, they created an RT-PCR test to detect "virus" in others -unpurified fetal rhesus Monkey kidney cell culture was used to determine a serological response -to determine the genetic sequence for an unknown "virus," they did a RANDOM RT-PCR assay -there were instances of other "pathogens" found in SARS cases such as E. Coli, Klebsiella Pneumoniae, and Haemophilus Influenzae -"virus" was "isolated" (i.e. cultured) in fetal rhesus monkey kidney cells from the lung biopsy and nasopharyngeal aspirate from TWO patients -CPE did not occur in the first passage but in subsequent ones -EM images came from the unpurified rhesus monkey kidney cell culture supernatant -they determined particles in the lung biopsy were similar in size and morphology to those that they found in the culture fluid and they decided they must be the same thing -of 30 cloned samples from the random primer RT-PCR assay, ONE showed a 646 bp fragment of unknown origin -this sequence had a WEAK HOMOLOGY to the "Coronaviridae" family -DEDUCED amino acid sequence had the highest homology (only 57%) to "bovine coronavirus" and "murine Hepatitis virus" -specific PCR primers were designed based on this 646 bp fragment from one cloned sample from one patient to detect the "virus" in others -of the 44 patient samples tested, only 22 were positive for this fragment -they ponder that if the INDIRECT methods of detecting seropositivity in ONE serum sample or detecting "viral" RNA in nasopharyngeal aspirates or feces can be used as evidence of infection, only then would 45 of the 50 patients be considered positive for the assumed "virus" -again, "virus" was only "isolated" (i.e. cultured) from TWO patients while the rest were deemed positive due to serological tests -their analysis was solely based on the unknown 646 bp fragment of one cloned sample (out of 30) -they state that no other pathogen was CONSISTENTLY detected so it must be this newly discovered "virus" which was never purified/isolated in this study nor proven pathogenic -however, they state while it is "highly likely" that "SARS-COV-1" is EITHER the cause of SARS or a PREREQUISITE for more serious disease, ruling out other microbial or non-microbial co-factors had yet to be investigated -they admit that finding "viral" RNA does not prove that the "virus" is viable or transmissible -they end by stating a "Coronavirus" is the causal agent of SARS yet there could be other "viruses" acting as secondary invaders In other words, the same small sample size, the same unpurified cell culture soup, the same unpurified EM images, the same useless serological tests, and the same assumptions/conclusions but this time with the further indirect PCR and genomic data added in to keep things fresh. Sadly, still no properly purified/isolated "virus" coming directly from the samples of sick patients, still no proven pathogenicity, and still no proper controls. Koch's Postulates Next time anyone says that Koch's Postulates are outdated or that it is not necessary to fulfill them in order to prove a "virus" causes disease, they should read this press release from the WHO during the 2003 SARS "pandemic" which states otherwise: "CONCLUSIVE IDENTIFICATION OF A CAUSATIVE MUST MEET ALL CRITERIA IN THE SO-CALLED “KOCH'S POSTULATE.” The additional experiments NEEDED TO FULFILL THESE CRITERIA are currently under way at a laboratory in the Netherlands." https://www.who.int/csr/don/2003_03_27b/en/ "WHO says coronavirus causes SARS Relating to the earlier post about the WHO stating Koch's Postulates must be satisfied in order to prove a "virus" is the cause of disease: "WHO says coronavirus causes SARS THE ORGANIZATION CLAIMED THAT ITS COLLABORATING LABORATORIES HAVE CONCLUDED THE CORONAVIRUS MEETS ALL FOUR OF "KOCH'S POSTULATES" for a causative agent: it must be found in all cases of the disease, it must be isolated from the host and grown in pure culture, it must reproduce the original disease when introduced into a susceptible host, and it must be found in the experimental host so infected." "ONE QUESTION STILL OPEN IS WHETHER THIS CORONAVIRUS IS TRULY THE ONLY VIRUS NEEDED TO CREATE THE DISEASE'S MOST ACUTE SYMPTOMS IN HUMANS. But now the virus is fully sequenced, laboratories like Frank Plummer's at the National Microbiology Laboratory WHICH ONLY DETECTED MINUTE AMOUNTS OF CORONAVIRUS, IN ABOUT HALF THE CASES OF SARS, AND SOME VIRUS IN PEOPLE WITHOUT SARS, will soon have much more effective PCR probes to search with." https://genomebiology.biomedcentral.com/.../gb-spotlight... So according to the WHO, a new "Coronavirus" was claimed as the cause of SARS by fulfilling Koch's postulates yet there was still the question of if the "new virus" was the ONLY CAUSE. Also, it was found by PCR in minute quantities in ONLY HALF of the SARS cases and also found in PEOPLE WITHOUT SARS. I'm starting to seriously doubt that the WHO truly understands Koch's Postulates Based on this, it immediately fails Koch's first Postulate: 1. The microorganism must be found IN ABUNDANCE IN ALL ORGANISMS SUFFERING FROM THE DISEASE, but should NOT BE FOUND IN HEALTHY ORGANISMS. THOMAS RIVERS 1937 REVISION OF KOCH'S POSTULATES: By 1937, it was clear that virologists were unable to satisfy any of Koch's Postulates in order to prove invisible particles assumed to be "viruses" existed and could cause disease. Even Robert Koch himself had difficulty with his own Postulates which led him to wiggle around some of them in attempts to prove pathogenicity of certain bacteria. Instead of accepting that the Postulates, as originally stated, worked and disproved the Germ Theory, virologists looked to various indirect immunological methods to prove their claims. This led to Thomas River's own attempts to water down Koch's Postulates by revising them to allow virologists even more wiggle room and expanding the 4 Postulates to 6. Unfortunately for all of Virology, Koch trapped them in a logical prison that they can not free themselves from. If they deny Koch's original Postulates, they are denying logic itself. Highlights from River's attempted revision below: VIRUSES AND KOCH'S POSTULATES "Even at the present time, THE CAUSE OF CERTAIN DISEASES IS SAID BY SOME INDIVIDUALS TO BE UNKNOWN OR UNDISCOVERED, because no cultivable bacteria or visible protozoan parasite of etiological significance has been demonstrated in them. For instance, A FEW YEARS AGO COWIE MADE THE STATEMENT IN A SCIENTIFIC PAPER THAT THE ETIOLOGICAL AGENT OF POLIOMYELITIS IS UNKNOWN, and in the recent book, An American Doctor's Odyssey, HEISER REMARKED THAT "THE MICROBE WHICH CAUSES SMALLPOX HAS NEVER BEEN DISCOVERED." "Microorganisms were known to exist long before their relation to disease was appreciated. After the discovery of this relation IT WAS NOT UNCOMMON FOR MORE THAN ONE KIND OF ORGANISM TO BE ACCREDITED WITH THE ABILITY OF PRODUCING THE SAME MALADY." "The above conditions laid down for the proof of the etiological relation of a microorganism to a disease constitute what are now known as Koch's postulates. His dictum has had a profound influence on workers investigating infectious maladies and FOR MANY YEARS AN INFECTIOUS AGENT WAS NOT ACCEPTED AS THE CAUSE OF A DISEASE UNLESS THE POSTULATES HAD BEEN SATISFIED. With the development of the science of immunology, however, immunological reactions added much to the knowledge of the specific relation of microbes to disease, and now IT IS POSSIBLE TO BRING EXCELLENT EVIDENCE THAT AN ORGANISM IS THE CAUSE OF A MALADY WITHOUT THE COMPLETE SATISFACTION OF THE POSTULATES. In spite of this fact, THERE ARE CERTAIN WORKERS WHO STILL REFUSE TO AGREE THAT THE CAUSE OF AN INFECTIOUS DISEASE HAS BEEN DISCOVERED UNLESS ALL THE CONDITIONS ORIGINALLY LAID DOWN BY KOCH HAVE BEEN MET. This is particularly true regarding the viral maladies, the etiological agents of which have not been cultivated on ordinary lifeless media." "IT IS OBVIOUS THAT KOCH'S POSTULATES HAVE NOT BEEN SATISFIED IN VIRAL DISEASES. Moreover, it is equally evident that proof of the etiological significance of viruses has been obtained without their satisfaction. Such a statement, however, does not imply that certain conditions do not have to be met before the specific relation of a virus to a disease is established. The conditions are: (a) A specific virus must be found associated with a disease with a degree of regularity. (b) The virus must be shown to occur in the sick individual not as an incidental or accidental finding but as the cause of the disease under investigation. IN MANY RESPECTS THE CONDITIONS JUST STATED FOR VIRAL MALADIES ARE SIMILAR TO THOSE OF KOCH for the proof of the specific relation of bacteria to disease. Nevertheless, THERE ARE CERTAIN DIFFERENCES. In the first place, IT IS NOT OBLIGATORY TO DEMONSTRATE THE PRESENCE OF A VIRUS IN EVERY CASE OF THE DISEASE PRODUCED BY IT. Secondly, the EXISTENCE OF VIRUS CARRIERS is recognized. Finally, IT IS NOT ESSENTIAL THAT A VIRUS BE GROWN ON LIFELESS MEDIA OR IN MODIFIED TISSUES CULTURES. How does one go about proving that a virus is the cause of a disease? Viruses, regardless of whether they are parasites OR THE FABRICATIONS OF AUTOCATALYTIC PROCESSES, are intimately associated with host cells and, therefore, should always be found at the proper time in specific lesions. In addition, viruses, as is the case with bacteria, may be found also in the blood stream, not necessarily multiplying there but appearing frequently only as a phenomenon of overflow from lesions in the tissues. With these facts in mind, tissues with lesions, exudate from such lesions, and blood are collected aseptically and inoculated into a susceptible experimental host of the same or different species. THE MATERIAL SHOULD BE FREE FROM ORDINARY MICROBES; IF NOT, THE MICROBES SHOULD BE KILLED OR REMOVED IN A PROPER MANNER, e.g., BY FILTRATION. If the inoculated animals become sick or die in a characteristic manner, and, if the disease in them can be transmitted from animal to animal by MEANS OF INOCULATIONS WITH BLOOD OR EMULSIONS OF INVOLVED TISSUES free from ordinary microbes or rickettsiae, ONE IS FAIRLY CONFIDENT THAT THE MALADY IN THE EXPERIMENTAL ANIMALS IS INDUCED BY A VIRUS. On the other hand, SUCH FINDINGS DO NOT NECESSARILY INDICATE THAT THE ACTIVE AGENT WAS PRESENT IN THE ORIGINAL MATERIAL USED FOR INOCULATION OF EXPERIMENTAL HOSTS. When a natural disease under investigation exhibits characteristic features, e.g., paralysis or intracellular inclusions, they are sought for in the experimental malady. IF ONE FINDS THEM, ONE IS ENCOURAGED, BUT PROOF IS STILL LACKING THAT THE VIRUS OPERATING IN THE EXPERIMENTAL HOSTS WAS PRESENT IN THE MATERIAL TAKEN FROM THE INDIVIDUAL WITH THE NATURAL INFECTION. Not infrequently several viruses produce the same clinical and pathological pictures, and at times the same virus does not induce similar changes in different hosts. Consequently, regardless of the disease picture produced in the experimental animals, ONE IS STILL FACED WITH THE PROBLEM OF DEMONSTRATING THAT THE VIRUS CAUSING IT WAS PRESENT IN THE MATERIAL USED FOR INOCULATION OF THE FIRST GROUP OF ANIMALS." "If a virus is the actual cause of a disease, immune substances are usually absent from the patients' serum at the onset of illness and make their appearance during the period of recovery. HOWEVER, THIS IS NOT UNIVERSALLY TRUE, INASMUCH AS RECOVERY SOMETIMES TAKES PLACE WITHOUT THE DEVELOPMENT OF ANTIBODIES, AND OCCASIONALLY AN INDIVIDUAL POSSESSING ANTIBODIES AGAINST A VIRUS SUCCUMBS TO A DISEASE CAUSED BY IT. ALTHOUGH THE ABSENCE OF ANTIBODIES FOR A VIRUS AT THE ONSET OF AN ILLNESS AND THEIR APPEARANCE LATER in the course of the disease or during convalescence CONSTITUTE HIGHLY SUGGESTIVE EVIDENCE that the virus is responsible for the malady, THEY ALONE SHOULD NOT BE ACCEPTED AS INCONTROVERTIBLE PROOF THAT SUCH IS THE CASE." "To summarize, IT CAN BE SAID THAT THE CAUSE OF VIRAL DISEASES IS KNOWN AND THAT KOCH'S POSTULATES AS PROPOSED BY HIM DO NOT HAVE TO BE FULFILLED IN ORDER TO PROVE THAT A VIRUS IS THE CAUSE OF A DISEASE. However, THE SPIRIT OF HIS RULES OF PROOF STILL HOLDS in that a worker must demonstrate that a virus is not only associated with a disease but that it is actually the cause. THE METHODS OF DOING THIS ARE DIFFERENT FROM THE ONES USED BY KOCH BUT ARE EQUALLY EFFICIENT. At the present time, this is accomplished by the production with A DEGREE OF REGULARITY of a transmissible infection in susceptible experimental hosts by means of inoculation of material, free from ordinary microbes or rickettsiae, obtained from patients with the natural disease, and by the demonstration THROUGH THE USE OF PROPER CONTROLS and immunological studies described above THAT THE VIRUS WAS NEITHER FORTUITOUSLY PRESENT IN THE PATIENTS NOR ACCIDENTALLY PICKED UP IN THE EXPERIMENTAL ANIMALS." https://jb.asm.org/content/jb/33/1/1.full.pdf In Summary: -there were people in the field who disagreed that "viruses" were the true cause of disease -Cowie made the claim that the agent responsible for Polio had yet to be discovered -Heiser remarked that a microbe causing Smallpox had never been discovered -it was not uncommon for more than one microbe/organism to be claimed as the cause of the same disease -for many years, it was accepted that Koch's Postulates must be fulfilled in order to prove an infectious agent causes disease -Rivers states it is possible to provide evidence an agent causes disease without fulfilling all of Koch's Postulates yet admits many are unwilling to accept this evidence without the Postulates being fulfilled -Rivers admits that it is obvious Koch's Postulates have not been satisfied for viral diseases -Rivers proposes his own revisions and states while they are similar to Koch's Postulates, they are different -Rivers allows for the "virus" not to be found in every case of disease -Rivers introduces the concept of "virus" carriers -Rivers states that "viruses" do not need to be grown in culture -Rivers admits that "viruses" could be fabrications of an autocatalytic process -he says that the sample must be free of other microbes and if not, they should be removed or killed by filtration -he believes that if an animal becomes sick or dies from inoculation of blood/emulsified tissues and then their blood/emulsified tissues produces disease/death in further inoculated animals, one can be FAIRLY CONFIDENT a "virus" is present -however, he says that this does not necessarily mean the agent that produced disease/death in the inoculated animals was the same as what was in the original sample -Rivers admits that even if they can reproduce the characteristics of a disease by experimentation in a lab, that still is not proof that what caused disease in the experiment was in the original sample from the sick patient or animal -he states it is a problem to show that what caused illness in subsequent animal inoculations was in the original inoculated animal -part of Rivers revisions stem from using immune response experiments as proof yet he admits that the presence/absence of antibodies is not universal and that people can recover without antibodies and can succumb to disease even with antibodies -he admits the the presence/absence of antibodies alone is not incontrovertible proof of a "virus" -Rivers concludes that "viruses" have been proven and that Koch's Postulates do not need to be fulfilled as originally proposed by him -Rivers states that his revisions still hold the spirit of Koch's Postulates -Rivers admits his Postulates are different than Koch's based on the methods used These are just a few highlights and I highly recommend reading the full 12 pages as there are many interesting admissions I unfortunately had to leave out. It is clear that Rivers revisions of Koch's Postulates are watered-down to make life easier for virologists to skirt around logic. Anyone claiming that they fulfilled Koch's Postulates by using the criteria laid down by Rivers are outright lying and being intentionally fraudulent...which in all honesty, sums up Virology to a T. DROSTEN 2003 SARS-COV-1 PAPER: Christian Drosten, a German Virologist who helped to create the problematic SARS-COV-2 PCR test without ever actually seeing a "virus" whilst having his paper and test quickly and suspiciously peer-reviewed and approved in just 24 hours, was also heavily involved in the original SARS-COV-1 "discovery" process. Below are some highlights from this paper: IDENTIFICATION OF A NOVEL CORONAVIRUS IN PATIENTS WITH SEVERE ACUTE RESPIRATORY SYNDROME "Methods Clinical specimens from patients with SARS were SEARCHED FOR UNKNOWN VIRUSES WITH THE USE OF CELL CULTURES AND MOLECULAR TECHNIQUES. Results A novel coronavirus was identified in patients with SARS. THE VIRUS WAS ISOLATED IN CELL CULTURE, and a sequence 300 nucleotides in length was obtained by a polymerase-chain- reaction (PCR)–based RANDOM-AMPLIFICATION PROCEDURE. Genetic characterization indicated that the virus is ONLY DISTANTLY RELATED TO KNOWN CORONAVIRUSES (IDENTICAL IN 50 TO 60 PERCENT OF THE NUCLEOTIDE SEQUENCES). On the basis of the obtained sequence, conventional and real-time PCR assays for specific and sensitive detection of the novel virus were established. Virus was detected in a variety of clinical specimens from patients with SARS but not in controls. High concentrations of viral RNA of up to 100 million molecules per milliliter were found in sputum. Viral RNA was also detected at extremely low concentrations in plasma during the acute phase and in feces during the late convalescent phase. Infected patients showed seroconversion on the Vero cells in which the virus was isolated. Conclusions The novel coronavirus MIGHT HAVE A ROLE in causing SARS." "Microbiologic testing for common pathogens A large number of tests for known respiratory pathogens were performed with specimens from all three patients in Frankfurt. The test results were negative, except as follows. PARAMYXOVIRUS-LIKE PARTICLES WERE SEEN IN THROAT SWABS AND SPUTUM SAMPLES FROM THE INDEX PATIENT BY ELECTRON MICROSCOPY. The particles were scarce. However, several PCR tests specific for virus species of the family Paramyxoviridae were negative (including tests for human metapneumovirus), as were PCR assays based on primers designed to react broadly with all members of that family. C. pneumoniae was not detected by PCR or antigen ELISA in sputum of the index patient from day 9. However, on day 11, ELECTRON MICROSCOPY OF CELLS IN A BRONCHOALVEOLAR-LAVAGE SPECIMEN FROM THE INDEX PATIENT SHOWED A SEVERE INTRACELLULAR BACTERIAL INFECTION, and the bronchoalveolar-lavage cells reacted in immunofluorescence analyses with a monoclonal antibody DIRECTED AGAINST C. PNEUMONIAE. Consistent with this finding, there was an increase by a factor of four in the C. pneumoniae IgA titer in the index patient between day 10 and day 13." "Isolation and characterization of a novel coronavirus AFTER SIX DAYS OF INCUBATION (on March 21), A CYTOPATHIC EFFECT WAS SEEN ON VERO-CELL CULTURES INOCULATED WITH SPUTUM OBTAINED FROM THE INDEX PATIENT on day 7. Twenty-four hours after a single passage, nucleic acids were purified from the supernatant. RANDOM AMPLIFICATION WAS PERFORMED WITH 15 DIFFERENT PCRs under low-stringency conditions. WE HAD PREVIOUSLY SHOWN THAT THIS METHOD IS ABLE TO DETECT UNKNOWN PATHOGENS GROWING IN CELL CULTURE (UNPUBLISHED DATA). To detect RNA viruses, an initial reverse-transcription step was included." "The principal finding of the study is the identification of a novel coronavirus in patients with SARS. IT APPEARS THAT PATIENTS WITH SARS ARE ACUTELY INFECTED WITH THIS VIRUS, SINCE THEY HAVE VIRUS-SPECIFIC IgG SEROCONVERSION. The high rate of positivity among patients WITH PROBABLE CASES during an outbreak of SARS in Hanoi, in conjunction with the complete negativity among all healthy contacts of patients affected by the same outbreak, provides evidence OF AN ASSOCIATION BETWEEN THE DISEASE AND THE PRESENCE OF THIS NOVEL VIRUS. The involvement of a coronavirus in a respiratory disease would not be without precedent: the two human coronaviruses are known to cause mild respiratory illness.9 ONE SHOULD BEAR IN MIND, HOWEVER, THAT IN THE PAST, VIRUSES HAVE BEEN INITIALLY ISOLATED FROM PATIENTS WITH A SPECIFIC DISEASE BUT SUBSEQUENT INVESTIGATIONS REVEALED NO ACTUAL ASSOCIATION AT ALL.10,11 Thus, LARGER STUDIES WITH APPROPRIATE CONTROL GROUPS ARE NEEDED TO VERIFY OR ELIMINATE OUR HYPOTHESIS ABOUT THE CAUSE OF SARS. The assays that have been established provide an excellent tool for such studies. It should also be taken into account that antigen that was present in primary cultures was used to detect the antibody response, and IT REMAINS TO BE FIRMLY ESTABLISHED THAT THIS RESPONSE IS INDEED DIRECTED AGAINST THE NOVEL CORONAVIRUS RATHER THAN AGAINST AN UNKNOWN AGENT THAT MIGHT HAVE BEEN ISOLATED SIMULTANEOUSLY. This possibility could be tested with the use of plaque-purified virus or recombinant proteins as antigen. By testing for a broad range of known pathogens, WE ALSO OBTAINED EVIDENCE FOR INFECTION WITH PARAMYXOVIRUSES AND C. PNEUMONIAE. Paramyxoviruses — In particular, human metapneumovirus, which was previously implicated in SARS12 — could be largely ruled out by further investigation. INFECTION WITH CHLAMYDIA WAS CONFIRMED IN SEVERAL ASSAYS. However, chlamydia was not found in other patients with SARS.3 Hence, IT REMAINS UNCLEAR WHETHER THESE PATHOGENS HAVE A ROLE AS CAUSATIVE FACTORS OR COFACTORS IN SARS." doi: 10.1056/NEJMoa030747 In Summary: -the aim of study was to detect unknown "viruses" by way of indirect methods such as cell culture and molecular techniques -they claim the "virus" was "isolated" in cell culture which is the exact opposite of isolation due to the adding/mixing of various foreign animal DNA, chemicals, nutrients, antibiotics, etc. with the sample -they utilized a RANDOM-amplification PCR procedure to detect sequence of the "virus" in cell culture fluids -the "virus" was considered to be DISTANTLY related to known "Coronaviruses" (only 50-60% identical in nucleotide sequences) -they created their own PCR tests to detect parts of this sequence in SARS patients -they determine that the "virus" MIGHT HAVE A ROLE in causing SARS -Paramyxovirus-like particles and C. Pneumoniae were also found in samples -CPE was seen after 7 days of incubation -random amplification of culture fluid by PCR was performed to detect a "novel virus" -they state that this method was shown to be able to detect unknown pathogens in UNPUBLISHED RESEARCH (Quick side note. This is from a study done in 2017, fourteen years after Drosten's paper stated they could detect unknown pathogens by PCR. This paper, along with examples from previous studies, states it is impossible: "However, EXTRACTION OF VIRAL RNA DIRECTLY FROM CULTURE OFTEN YIELDS VIRAL RNA WITH HIGH HOST RNA BACKGROUND (Marston et al. 2013)." "Similarly, Cowan et al. (2005) noted that PCR-based enrichment techniques where A PRIORI KNOWLEDGE OF TARGET SEQUENCES IS REQUIRED FOR PCR PRIMER DESIGN RENDER THE ENRICHMENT STRATEGIES INEFFECTIVE IN THE CHARACTERIZATION OF NOVEL VIRUSES. It follows that the SAME SEQUENCE AMBIGUITY IN VIRAL GENOMES WOULD POSE A PROBLEM FOR USING CUSTOMIZED SEQUENCING ADAPTERS DURING DIRECT RNA SEQUENCING." https://amb-express.springeropen.com/articles/10.1186/s13568-019-0772-y Maybe this is why Drosten's data proving his method went UNPUBLISHED...but I digress...) -they assume patients with SARS are infected due to "virus-specific" seroconversion which is impossible to determine without a purified/isolated "virus" -they admit that "viruses" have been "isolated" in the past which were believed to be the cause of disease and turned out not to be so -they admit LARGER studies with APPROPRIATE CONTROLS need to be done in order to verify or eliminate their HYPOTHESIS -they admit that there needs to be confirmation that the antibody response needs to be confirmed as being due to this new "coronavirus" rather than some unknown agent which may have been "isolated" along with it -since they also "isolated" Paramyxoviruses, C. Pneumoniae, and Chlamydia from SARS patients, it remains unclear whether these also play a role in SARS Note that once again there was no properly purified/isolated "virus" taken directly from a sick patient nor proven pathogenic. There were no accompanying EM images as they used an indirect PCR method to sequence an unknown "virus." The only evidence any new "virus" exists at all from this paper comes from random letters in a computer database. (Below image is not from this study.) POUTANEN 2003 SARS-COV-1 PAPER: This is one of the four papers used as evidence that SARS-COV-1 fulfilled Koch's Postulates. It fails miserably as there is no properly purified/isolated "virus" taken directly from a sick patient nor is there any proof of pathogenicity in this paper. On top of that, they do not determine if it is a new "coronavirus," a metapneumovirus, both of them, or some other unknown pathogen causing SARS. Highlights from the study below: IDENTIFICATION OF SEVERE ACUTE RESPIRATORY SYNDROME IN CANADA "The results of laboratory investigations were negative or not clinically significant EXCEPT FOR THE AMPLIFICATION OF HUMAN METAPNEUMOVIRUS FROM RESPIRATORY SPECIMENS FROM FIVE OF NINE PATIENTS and the isolation and amplification of a novel coronavirus from five of nine patients. IN FOUR CASES BOTH PATHOGENS WERE ISOLATED." "CONCLUSIONS SARS is a condition associated with substantial morbidity and mortality. It appears to be of viral origin, with patterns suggesting droplet or contact transmission. THE ROLE OF HUMAN METAPNEUMOVIRUS, A NOVEL CORONAVIRUS, OR BOTH REQUIRES FURTHER INVESTIGATION." "Further virologic studies were completed on all respiratory specimens received from 9 of the 10 patients. THESE INCLUDED VIRAL CULTURES (INCLUDING INOCULATION ONTO CELL CULTURE AND INTO EMBRYONATED HEN EGGS AND INTRACEREBRAL INOCULATION OF SUCKLING MICE), immune electron microscopy of nasopharyngeal swabs and bronchoalveolar fluids with serum obtained during the convalescent phase from Patient 10, RT-PCR for conserved portions of the polymerase gene of RNA viruses, and nested RT-PCR with genus-specific degenerative primers for paramyxoviruses and bunyaviruses. Results for all of these tests have been negative, with two exceptions. HUMAN METAPNEUMOVIRUS WAS AMPLIFIED by nested RT-PCR from bronchoalveolar-lavage fluid and nasopharyngeal swabs FROM FIVE OF NINE PATIENTS WITH SARS AND FROM A NASOPHARYNGEAL SWAB FROM AN ASYMPTOMATIC CONTACT OF ONE OF THE PATIENTS in Toronto (Patient 3) with use of the following primer pair: 5'CTTTGGACTTAATGACAGATG3' and 5'GTCTTCCTGTGCTAACTTTG3'.4 For confirmation of these positive findings, the amplicons were sequenced and found to be unique, ruling out the possibility of cross-contamination in the laboratory. In addition, A NOVEL CORONAVIRUS WAS ISOLATED FROM VERO CELL CULTURES INOCULATED WITH RESPIRATORY SPECIMENS FROM FIVE OF NINE PATIENTS WITH SARS. FOUR OF THESE PATIENTS HAD SPECIMENS FROM WHICH METAPNEUMOVIRUS WAS ALSO IDENTIFIED. A cytopathic effect on the Vero cell cultures was noted on day 6 of incubation. On the basis of collaboration with investigators in Hong Kong and at the Centers for Disease Control and Prevention (CDC) in Atlanta, who reported isolating a novel coronavirus from patients with SARS in other areas of the world, RT-PCR was completed targeting conserved regions of the coronavirus polymerase gene using the following primer pair: 5'CAGAGCCATGCCTAACATG3' and 5'AATGTTTACGCAGGTAAGCG3'. A novel coronavirus identical to that reported by the CDC2 was amplified from all five cultures. In addition, nested RT-PCR using the same primers plus 5'TGTTAAACCAGGTGGAAC3' and 5'CCTGTGTTGTAGATTGCG3' amplified the coronavirus directly from bronchoalveolar-lavage fluid FROM THREE OF NINE PATIENTS TESTED, ALL OF WHOM ALSO HAD CORONAVIRUS ISOLATED FROM CELL CULTURE as described above." "At a different laboratory, a coronavirus was also identified independently by amplification directly from bronchoalveolar-lavage fluid FROM THREE OF SIX PATIENTS TESTED. All three of these patients had coronavirus ISOLATED FROM CELL CULTURE and amplification as described above." "FURTHER STUDIES ARE CURRENTLY BEING COMPLETED TO HELP DETERMINE WHETHER THE HUMAN METAPNEUMOVIRUS AND A NOVEL CORONAVIRUS, EITHER ALONE OR IN COMBINATION, ARE THE CAUSE OF SARS OR WHETHER OTHER THUS FAR UNDETECTED PATHOGENS ARE POSSIBLY RESPONSIBLE. The possibility that coinfection of either virus with another agent may be responsible for SARS cannot be excluded." "Epidemiologic investigations and laboratory studies SUGGEST THAT MOST PATIENTS with disease meeting the definition of SARS in both Toronto and Vancouver CAN BE LINKED TO A COMMON SOURCE AND TO COMMON POTENTIAL CAUSATIVE AGENTS. On the basis of preliminary investigations, it appears that this syndrome MAY BE DUE IN PART TO THE NEWLY DESCRIBED RESPIRATORY VIRAL PATHOGEN, HUMAN METAPNEUMOVIRUS,6 TO A NOVEL CORONAVIRUS, OR BOTH. EVIDENCE OF THE ROLE OF HUMAN METAPNEUMOVIRUS INCLUDES ITS AMPLIFICATION FROM RESPIRATORY SPECIMENS FROM FIVE OF NINE CANADIAN PATIENTS WITH SARS AND ONE ASYMPTOMATIC CONTACT AND THE IDENTIFICATIONS OF A METAPNEUMOVIRUS FROM RESPIRATORY SPECIMENS FROM OTHER NON-CANADIAN PATIENTS WITH SARS (Tam J, Department of Microbiology, Chinese University of Hong Kong: personal communication). In addition, THE RANGE OF CLINICAL FINDINGS, from asymptomatic disease to severe pneumonia and death, IS SIMILAR TO THAT DESCRIBED IN HUMAN METAPNEUMOVIRUS INFECTION.7 On the other hand, the severity with which the Canadian cases of SARS presented and the high attack rate of SARS among close contacts have not been described in patients with human metapneumovirus infection, suggesting that human metapneumovirus alone may not be responsible for SARS, that a genetic variant of the human metapneumovirus is potentially responsible, or that human metapneumovirus is not related to SARS but is an incidental finding. Indeed, we know little about the prevalence of asymptomatic carriage of human metapneumovirus, and such information would be helpful in interpreting the meaning of our amplification of this virus in patients meeting the criteria for SARS.8,9 THE NOVEL CORONAVIRUS IDENTIFIED IN FIVE OF NINE CANADIAN CASES MAY ALSO BE A POSSIBLE CAUSATIVE AGENT OF SARS. Further evidence includes its identification by other investigators around the world from specimens from other patients with SARS and reports of positive immunofluorescence antibody tests in serum from patients from whom the coronavirus was isolated.2 In addition, known human coronaviruses are recognized to cause respiratory infection, albeit typically less severe than that described in the Canadian patients with SARS.10 Finally, coronaviruses are known to infect both animals and humans, and it is logical to consider that the emergence of a new disease may be related to the emergence of a novel coronavirus that originated with a limited range of animal hosts and evolved to involve an altered range that now includes humans. ALTHOUGH ONE CAN SPECULATE ABOUT THE POSSIBLE ROLES OF BOTH CORONAVIRUSES AND HUMAN METAPNEUMOVIRUS IN SARS, IT IS CURRENTLY NOT CLEAR WHAT ROLE, IF ANY, EITHER OF THESE VIRUSES HAS IN CAUSING SARS. FURTHER COLLABORATIVE INVESTIGATIONS ARE NEEDED." "THE MECHANISM OF TRANSMISSION OF THE AGENT OR AGENTS CAUSING SARS IS NOT YET UNDERSTOOD." https://www.nejm.org/doi/full/10.1056/NEJMoa030634 In Summary: -a metapneumovirus was "isolated" in 5 out of 9 SARS patients as well as from one asymptomatic contact -"SARS-COV-1" was also only "isolated" from 5 out of 9 patients -in 4 out of 9 cases, both the metapneumovirus and "SARS-COV-1 were "isolated" -they concluded that the metapneumovirus, the new "Coronavirus," OR BOTH need to be investigated further -cell cultures and inoculation into embryonated hen eggs and intracerebral inoculation into suckling mice brains were carried out -the "novel coronavirus" was cultured in Vero cells yet the materials used beyond that are undefined -RT-PCR was only able to detect "SARS-COV-1" in 3 out of 9 patients -at an independent lab, only 3 of 6 patients had "SARS-COV-1 RNA detected by PCR -they state further studies are under way to determine if it is the metapneumovirus, "SARS-COV-1," a combo of the 2, or some other unknown pathogen causing SARS -coinfection with either "virus" and another unknown agent could not be excluded -evidence SUGGESTS that most patients with SARS could be linked to a common source and to common POTENTIAL causative agents -beyond this study, metapneumoviruses were "isolated" from non-Canadians with SARS -the range in clinical symptoms in SARS is similar to metapneumovirus infection -they determine that it is not clear what role, IF ANY, that the "new Coronavirus" or the metapneumovirus may have in relation to SARS -they state further collaborative investigations are needed -the method of transmission for the agent or agents causing SARS is not yet understood It is clear upon reading this study that not only do they not prove "SARS-COV-1" as the cause of SARS, they make an even better case that it could be metapneumovirus. Even then, they state that they can not conclude whether it is the new "Coronavirus," the metapneumovirus, both, neither, or some as of yet undiscovered agent that could be the cause of SARS. If there is one thing made clear from this study, they were unable to determine anything at all. KSIAZEK 2003 SARS-COV-1 PAPER: This is another of the four papers used to say that Koch's Postulates, or at least some of them, were fulfilled for "SARS-COV-1." Once again, they fail at even fulfilling the first two Postulates. The "virus" is not found in all cases of SARS nor is it ever properly purified/isolated directly from a sick host nor proven pathogenic. They use the same unpurified cell cultures and do not disclose the materials used during the culturing process.This study does try to implement many indirect serological and molecular techniques to prove a causative relationship between a novel "Coronavirus" and SARS, but these techniques (such as RT-PCR, immunohistochemical and immunofluorescence staining, as well as Indirect fluorescence antibody tests and enzyme-linked immunosorbent assays) are not requirements of Koch's Postulates nor are they reliable measures to identify a "novel virus." Highlights from the study below: A NOVEL CORONAVIRUS ASSOCIATED WITH SEVERE ACUTE RESPIRATORY SYNDROME "RESULTS None of the previously described respiratory pathogens were consistently identified. However, a novel coronavirus was isolated from patients who met the case definition of SARS. CYTOPATHOLOGICAL FEATURES WERE NOTED IN VERO E6 CELLS INOCULATED WITH A THROAT-SWAB SPECIMEN. Electron-microscopical examination revealed ultrastructural features characteristic of coronaviruses. Immunohistochemical and immunofluorescence staining revealed reactivity with group I coronavirus polyclonal antibodies. CONSENSUS CORONAVIRUS PRIMERS DESIGNED TO AMPLIFY A FRAGMENT OF THE POLYMERASE GENE by reverse transcription–polymerase chain reaction (RT-PCR) were used to obtain a sequence that clearly identified the isolate as a unique coronavirus ONLY DISTANTLY RELATED TO PREVIOUSLY SEQUENCED CORONAVIRUSES. With specific diagnostic RT-PCR primers we identified several identical nucleotide sequences in 12 patients from several locations, a finding consistent with a point-source outbreak. Indirect fluorescence antibody tests and enzyme-linked immunosorbent assays made with the new isolate have been used to demonstrate a virus-specific serologic response. This virus may never before have circulated in the U.S. population." "Methods GENERAL APPROACH THE NONSPECIFIC NATURE OF THE CLINICAL PRESENTATION OF PATIENTS WITH SARS and the urgency of finding a cause required that clinical specimens be tested rapidly for a broad range of viral, bacterial, chlamydial, and rickettsial agents (the CDC case definition of SARS is available as Supplementary Appendix 1 with the full text of this article at http://www.nejm.org). Laboratory testing focused foremost on known respiratory pathogens, especially those that might specifically target the lower respiratory tract through the progression of disease. A combination of traditional methods was applied, INCLUDING VIRUS ISOLATION IN SUCKLING MICE AND CELL CULTURE, electron microscopy, histopathological examination, serologic analysis, and general and specialized bacterial culture techniques. The molecular techniques of polymerase chain reaction (PCR), reverse-transcription PCR (RT-PCR), and real-time PCR were used. Priority was given to testing for the following agents: yersinia, mycoplasma, chlamydia, legionella, Coxiella burnetii, spotted fever and typhus group rickettsiae, influenza viruses A and B, Paramyxovirinae and Pneumovirinae subfamily viruses (specifically, human respiratory syncytial virus and human metapneumovirus), Mastadenoviridae, Herpetoviridae, Picornaviridae, Old and New World hantaviruses, and Old World arenaviruses." "ISOLATION OF VIRUS TO IDENTIFY VIRUSES ASSOCIATED WITH SARS, WE INOCULATED A VARIETY OF CLINICAL SPECIMENS (blood, serum, material from oropharyngeal swabs or washings, material from nasopharyngeal swabs, and tissues of major organs collected at autopsy) ONTO A NUMBER OF CONTINUOUS CELL LINES, including Vero E6, NCI-H292, MDCK, LLC-MK2, and B95-8 cells, AND INTO SUCKLING ICR MICE BY THE INTRACRANIAL AND INTRAPERITONEAL ROUTES. All cultures were observed daily for cytopathic effect. MAINTENANCE MEDIUM WAS REPLENISHED AT DAY 7, and cultures were terminated 14 days after inoculation. ANY CULTURES EXHIBITING IDENTIFIABLE CYTOPATHIC EFFECT WERE SUBJECTED TO SEVERAL PROCEDURES TO IDENTIFY THE CAUSE OF THE EFFECT. Suckling mice were observed daily for 14 days, and WE FURTHER TESTED ANY SICK OR DEAD MICE BY PREPARING A BRAIN SUSPENSION THAT WAS FILTERED AND SUBCULTURED. Mice that remained well after 14 days were euthanized, and their test results were recorded as negative. TISSUE-CULTURE SAMPLES SHOWING CYTOPATHIC EFFECT WERE PREPARED FOR ELECTRON-MICROSCOPICAL EXAMINATION. Negative-stain electron-microscopical specimens were prepared by drying culture supernatant, mixed 1:1 with 2.5 percent paraformaldehyde, onto Formvar Carbon-coated grids and staining with 2 percent methylamine tungstate. Thin-section electron-microscopical specimens were prepared by fixing a washed cell pellet with 2.5 percent glutaraldehyde and embedding it in epoxy resin. FOR RT-PCR ASSAYS, CELL-CULTURE SUPERNATANTS WERE PLACED IN LYSIS BUFFER. In addition, a master seed was prepared from the remaining culture supernatant and cells by freeze-thawing the culture flask, clarifying the thawed contents by centrifugation at 1000×g,and dispensing the supernatant into aliquots stored in gas phase over liquid nitrogen. The master seed was subcultured into 850-cm2roller bottles of Vero E6 cells for the preparation of formalin-fixed positive control cells for immunohistochemical analysis, mixed with normal E6 cells, and gamma-irradiated for preparation of spot slides for indirect fluorescence antibody tests or extracted with detergent and gamma-irradiated for use as an enzyme-linked immunosorbent assay (ELISA) antigen for antibody tests." "We used the following antibody and tissue controls: SERUM SPECIMENS FROM NON INFECTED ANIMALS, VARIOUS CORONAVIRUS-INFECTED CELL CULTURES AND ANIMAL TISSUES, NONINFECTED CELL CULTURES, and NORMAL HUMAN AND ANIMAL TISSUES." "TWO CELL LINES, VERO E6 CELLS AND NCI-H292 CELLS, inoculated with oropharyngeal specimens from Patient 16 (a 46-year-old male physician with an epidemiologic link to a hospital with multiple patients with SARS) initially showed cytopathic effect (Table 1). Blood, nasopharyngeal, and throat-swab specimens were collected on March 12, day 1 after onset. At that time, the patient's physical examination was normal except for fever and shortness of breath. During the course of the disease, his status worsened, and he died. A RHINOVIRUS WAS ISOLATED FROM THE INOCULATED NCI-H292 CELLS. Further study suggested that this virus was not associated with patients with SARS, so it will not be discussed here." "EXAMINATION OF CYTOPATHIC-EFFECT–POSITIVE VERO E6 CELLS by thin-section electron microscopy revealed CHARACTERISTIC CORONAVIRUS PARTICLES within the cisternae of the rough endoplasmic reticulum and in vesicles (Figure 2A).14,15 EXTRACELLULAR PARTICLES WERE FOUND IN LARGE CLUSTERS and adhering to the surface of the plasma membrane. Negative-stain electron microscopy identified coronavirus particles, 80 to 140 nm in diameter, with 20-to-40-nm complex surface projections surrounding the periphery (Figure 2B). Hemagglutinin esterase-type glycoprotein projections were not seen." "Lung tissues were obtained at autopsy from three patients and by open-lung biopsy in one patient, 14 to 19 days after the onset of SARS. Confirmatory laboratory evidence of infection with coronavirus was available for two patients (Patients 6 and 17) and included PCR amplification of coronavirus nucleic acids from tissues, viral isolation from bronchoalveolar-lavage fluid, or detection of serum antibodies reactive with coronavirus (Table 1). FOR TWO PATIENTS, NO SAMPLES WERE AVAILABLE FOR MOLECULAR, CELL-CULTURE, OR SEROLOGIC ANALYSIS; HOWEVER, THE CONDITION OF BOTH PATIENTS MET THE CDC DEFINITION OF PROBABLE SARS, and both had strong epidemiologic links with laboratory-confirmed cases of SARS." "NO OBVIOUS INTRANUCLEAR OR INTRACYTOPLASMIC VIRAL INCLUSIONS WERE IDENTIFIED (Figure 4B), AND ELECTRON-MICROSCOPICAL EXAMINATION OF A LIMITED NUMBER OF THESE SYNCYTIAL CELLS REVEALED NO CORONAVIRUS PARTICLES. NO DEFINITIVE IMMUNOSTAINING WAS IDENTIFIED IN TISSUES FROM SARS PATIENTS with the use of a battery of immunohistochemical stains reactive with coronaviruses from antigenic groups I, II, and III." "EVALUATION OF VERO E6 CELLS INFECTED WITH CORONAVIRUS ISOLATED FROM A PATIENT WITH SARS revealed viral cytopathic effect that included occasional multinucleated syncytial cells BUT NO OBVIOUS VIRAL INCLUSIONS (Figure 4C)." "PATIENTS Nineteen patients with SARS have been identified as infected with the new coronavirus BY VIRUS ISOLATION, RT-PCR, OR SEROLOGIC TESTS; all have direct or indirect links to the SARS outbreak in Hong Kong or Guangdong Province, China (Table 1). WE WERE ABLE TO AMPLIFY BY RT-PCR AND OBTAIN THE VIRUS SEQUENCE from clinical specimens or virus isolates FROM 12 OF THESE PATIENTS. All 12 sequences were identical to those of the first isolate as noted above. FOR FOUR CONVALESCENT PATIENTS, INFECTION WAS DEFECTED SEROLOGICALLY ALONE; FOR NINE PATIENTS IT WAS DETECTED BY RT-PCR ALONE; FOR THREE BY VIRUS ISOLATION AND RT-PCR; FOR TWO BY VIRUS ISOLATION, RT-PCR, AND SEROLOGIC ANALYSIS; AND FOR ONE BY RT-PCR AND SEROLOGIC ANALYSIS. We found none of the coronavirus-infected patients to be infected with human metapneumovirus. In only one patient was both SARS coronavirus and another respiratory virus detected; Patient 16 had both SARS coronavirus and a rhinovirus. A VARIETY OF RESPIRATORY PATHOGENS WERE ALSO IDENTIFIED BY RT-PCR IN OTHER PATIENTS WHOSE SAMPLES WERE SUBMITTED FOR SARS TESTING, INCLUDING 5 WITH HUMAN METAPNEUMOVIRUS (sequencing showed that each was distinct) AND 12 WITH RHINOVIRUSES (sequencing showed that each was distinct). None of the patients who were positive for human metapneumovirus had pneumonia.`` "Discussion The isolation of a novel coronavirus from the respiratory secretions of a patient with SARS and the subsequent demonstration of this virus or a serologic response to this virus in others with SARS DEMONSTRATE AN ETIOLOGIC ASSOCIATION between this virus and SARS." "The novel human coronavirus identified in this study shares antigenic features with various group I coronaviruses, but genetic comparisons suggest it is distinct from group I coronaviruses and from coronaviruses in groups II and III. The factor or factors responsible for this apparent dichotomy remain to be elucidated; however, CORRELATION BETWEEN ANTIGENIC AND GENETIC CHARACTERISTICS OF THESE VIRUSES IS OCCASIONALLY UNCLEAR, AND THE PLACEMENT OF SOME OTHER HUMAN CORONAVIRUSES WITHIN SPECIFIC ANTIGENIC GROUPS HAS NOT ALWAYS BEEN WELL DEFINED.18-20" "THE IDENTIFICATION OF THIS NOVEL CORONAVIRUS RELIED ON CLASSIC TISSUE-CULTURE ISOLATION TO AMPLIFY THE PATHOGEN AND THEN ON ELECTRON-MICROSCOPICAL STUDIES TO IDENTIFY THE TYPE OF VIRUS, a member of the family Coronaviridae, and molecular studies to confirm the identity of the virus, characterize its unique nature, AND HELP LINK IT TO THE DISEASE. The discovery of this new virus underscores the importance of versatile techniques such as virus isolation and electron microscopy in identifying etiologic pathogens. As with previous outbreak investigations, ELECTRON MICROSCOPY PROVED TO BE A RAPID TECHNIQUE THAT DID NOT REQUIRE SPECIFIC REAGENTS FOR OR PRIOR KNOWLEDGE OF A PARTICULAR AGENT BUT THAT COULD NEVERTHELESS CATEGORIZE A PATHOGEN ON THE BASIS OF ITS APPEARANCE AND MORPHOGENESIS.21-24" "WE WERE NOT, HOWEVER, ABLE TO DEMONSTRATE CORONAVIRUS ANTIGENS IN PATIENT TISSUES BY HISTOLOGIC AND IMMUNOHISTOCHEMICAL METHODS OR TO DEMONSTRATE A DIRECT INVOLVEMENT IN THE PATHOLOGIC PROCESS. NEITHER WERE WE ABLE TO DEMONSTRATE SARS-ASSOCIATED CORONAVIRUS INFECTION IN ALL SUSPECTED PATIENTS WITH SARS." "POSSIBLE REASONS FOR THE INABILITY TO DEMONSTRATE INFECTION IN SOME PATIENTS WITH SUSPECTED SARS include the lack of sufficient sensitivity of the assays to detect the pathogen and the immune response and the timing and type of specimens tested. For example, we have not yet received convalescent-phase serum specimens from many patients with suspected SARS and have not serologically ruled out infection in many such patients. In addition, we are just beginning to study the type and timing of clinical specimens most likely to support a diagnosis of infection with this new virus. We have made rapid progress in developing our diagnostic assays and are continuing to improve them for the detection of this virus or an immune response to it. IN ADDITION, THE CASE DEFINITION OF SARS IS VERY BROAD AND MOST LIKELY INCLUDES OTHER INFECTIOUS DISEASES. WE ARE ALSO CONTINUING TO TEST FOR OTHER INFECTIOUS AGENTS THAT MIGHT BE ASSOCIATED WITH SARS, including those that might contribute to the severity of disease or increase the efficiency of viral transmission. Further clinical analysis of patients with SARS in whom there is laboratory confirmation of infection with the new coronavirus might help refine the case definition further." "THE ISOLATION AND GROWTH OF A HUMAN-DERIVED CORONAVIRUS IN VERO E6 CELLS WERE UNEXPECTED. THE ONLY HUMAN OR ANIMAL CORONAVIRUS THAT HAS BEEN SHOWN TO GROW IN VERO CELLS IS PORCINE EPIDEMIC DIARRHEA VIRUS (isolated in China from pigs), AND IT REQUIRES THE ADDITION OF TRYPSIN TO CULTURE MEDIUM FOR GROWTH IN VERO E6 CELLS.25However, like the sequences of the other known coronaviruses, the sequences for porcine epidemic diarrhea virus are distinct from those of SARS-associated coronavirus, indicating that porcine epidemic diarrhea virus is not the parent virus to this new coronavirus. Because of the death of Dr. Carlo Urbani during the investigation, we propose that our first isolate be named the Urbani strain of SARS-associated coronavirus." "THE PRIMARY HISTOPATHOLOGICAL LESIONS seen in the lungs of four patients we studied ARE CONSISTENT WITH A NONSPECIFIC RESPONSE TO ACUTE LUNG INJURY THAT CAN BE CAUSED BY INFECTIOUS AGENTS, TRAUMA, DRUGS, OR TOXIC CHEMICALS." https://www.nejm.org/doi/full/10.1056/nejmoa030781 In Summary: -throat-swab specimens were inoculated onto Vero E6 cells and cultured until cytopathogenic effects was observed -CONSENSUS "Coronavirus" primers were designed for a fragment of the polymerase gene and the sequence was found to be distantly related to other "Coronaviruses" -SARS had a nonspecific clinical representation necessitating them to look at various possible agents for the cause -cell cultures and inoculations in suckling mice were utilized to find the "virus" -a variety of clinical specimens and numerous continuous cell lines were used to culture "viruses" and were inoculated intracranially (brain) and intraperitoneally (stomach) into suckling mice -cultures were checked daily for CPE and medium was replenished on day 7 -if they noticed IDENTIFIABLE CPE, they went searching for a CAUSE -any sick or dead suckling mice had their brains put into a suspension and then filtered/subcultured -unpurified tissue-cultures showing CPE were examined by EM -unpurified cell culture supernatant was put into lysis buffer for RT-PCR assays -for antibody and tissue culture controls, they used serum from noninfected animals, various "Coronavirus-infected" cell cultures and animal tissues, "non infected" cell cultures, and normal human and animal tissues - however, there is no mention of taking samples from healthy humans for controls -a rhinovirus was "isolated" from the unpurified cell culture from one patient but it was deemed unimportant -unpurified Vero cell cultures which showed CPE were checked by EM for "Coronavirus-like" particles -many extracellular particles in large groupings were found and assumed to be "Coronaviruses" -two patients were deemed SARS cases even without molecular, cell culture, or serologic evidence as they met the CDC definition for PROBABLE SARS -no intranuclear or intracytoplasmic viral particles were found -EM examination of syncytial cells revealed no "Coronavirus" particles -no definitive immunostaining was identified in SARS tissues -evaluation of Vero cell culture revealed no obvious viral inclusions -only 12 of 19 patients yielded PCR sequences of the new "Coronavirus" -"SARS-COV-1" infection was determined by either cell culture, RT-PCR, and/or serologic tests -a variety of respiratory pathogens were identified by RT-PCR in SARS specimens such as 5 metapneumovirus and 12 rhinoviruses -they state that their cell culture and serologic evidence provides an etiologic ASSOCIATION between the "virus" and SARS -they admit correlation between antigenic and genetic characteristics of "Coronaviruses" are unclear and placement of human "Coronaviruses" in antigenic groups is not well-defined -they identified the "virus" through tissue-culture to amplify the "virus," EM imaging of unpurified cell culture supernatant to find the "virus" they were looking for, and molecular techniques to confirm its identity (sounds familiar...) -they admit EM does not need reagents nor prior knowledge of a "virus" to find one as they rely on appearance and morphogenesis to determine it is there within the unpurified cell culture -they admit they were unable to demonstrate "Coronavirus" antigens in patient tissues by histologic or immunohistochemical methods nor prove direct involvement in the pathologic process -they were also UNABLE to demonstrate "SARS-COV-1" infection IN ALL SARS PATIENTS -they admit that the case definition for SARS is very broad and encompasses many other diseases -they state they are continuing to look for other infectious agents that may be the cause of SARS -they state that growing a human "Coronavirus" in Vero cells was unexpected yet admit a pig "Coronavirus" has been grown this way when trypsin is added to the media -the lung trauma seen in SARS patients is consistent with lung injury that can be caused by trauma, drugs, or toxic chemicals As stated earlier, they fail to provide evidence of a purified/isolated "virus" taken directly from a sick patient which is then proven pathogenic. At least they admit they were unable to show "SARS-COV-1" in all SARS patients thus failing Koch's first Postulate invalidating this whole study as proof that the Postulates have been fulfilled. They also admit they are continuing to look for other infectious agents as the possible cause of SARS, again disqualifying this study as proof. FOUCHIER 2003 SARS-COV-1 KOCH'S POSTULATES FULFILLED(?): "It is obvious that KOCH'S POSTULATES HAVE NOT BEEN SATISFIED in viral diseases." -Thomas Rivers 1937 During the 2003 SARS "epidemic," the WHO regularly announced updates about their search for the causative agent of what was claimed to be a new disease. On March 27th, 2003, they admitted that the criteria that needed to be fulfilled in order to prove that there was a new "virus" causing a new disease was Koch's Postulates: four logic based rules proposed by Robert Koch that have been the burden of proof since the late 1800's: "CONCLUSIVE IDENTIFICATION OF A CAUSATIVE MUST MEET ALL CRITERIA IN THE SO-CALLED “KOCH'S POSTULATE.” The additional experiments NEEDED TO FULFILL THESE CRITERIA are currently under way at a laboratory in the Netherlands." -WHO 2003 https://www.who.int/csr/don/2003_03_27b/en/ On April 15th, 2003, the WHO stated that the experiments were done and that the criteria for satisfying Koch's Postulates had been met thus proving that the "new" disease SARS was caused by a new "Coronavirus:" "Scientists had been almost certain the new form of coronavirus first isolated from sick patients March 21 by the University of Hong Kong was the cause of SARS. BUT THEY COULD NOT SAY FOR SURE UNTIL THEY HAD SATISFIED WHAT IS KNOWN AS KOCH'S POSTULATES _ FOUR SCIENTIFIC TESTS THAT VERIFY WHETHER A VIRUS CAUSES A CERTAIN DISEASE. "THE KOCH'S POSTULATES HAVE BEEN FULFILLED, SO WE CAN NOW SAY FOR CERTAIN THAT THE NEW CORONAVIRUS IS THE CAUSE OF SARS," said Dr. Klaus Stohr, a World Health Organization virologist who is coordinating the scientists' work. https://www.mrt.com/news/article/Scientists-Confirm-Virus-As-Cause-of-SARS-7816916.php Ron Fouchier, the lead researcher for the 2003 SARS paper claiming fulfillment of Koch's Postulates, stated this in 2012 while speaking about MERS: "For starters, we'll find out whether animals get sick from this virus. YOU CAN ISOLATE A VIRUS FROM A PATIENT, BUT THAT DOES NOT MEAN THEY DIED FROM IT; TO SHOW THAT IT CAUSES DISEASE YOU NEED TO FULFILL KOCH'S POSTULATES. THAT'S WHAT WE DID FOR SARS, and it's what we hope to do here; we've applied for emergency ethical approval. The most obvious animal species to put this virus in are mice, ferrets, and perhaps monkeys. We've got to see what we can get approval for." https://www.sciencemag.org/news/2012/09/ron-fouchier-new-coronavirus-we-need-fulfill-kochs-postulates According to the WHO and lead researcher Ron Fouchier, all of Koch's Postulates had been met and the newly identified "SARS-COV-1" was the true cause of SARS. However, did they really satisfy Koch's Postulates for SARS? KOCH'S POSTULATES FULFILLED FOR SARS VIRUS "ACCORDING TO KOCH'S POSTULATES, AS MODIFIED BY RIVERS FOR VIRAL DISEASES, SIX CRITERIA ARE REQUIRED to establish a virus as the cause of a disease1. THE FIRST THREE CRITERIA — isolation of virus from diseased hosts, cultivation in host cells, and proof of filterability — HAVE BEEN MET FOR SCV BY SEVERAL GROUPS 2,3,4,5. Moreover, of 96 individuals complying with the World Health Organization's definition of SARS6 in Hong Kong, 86 (90%) yielded laboratory evidence of SCV infection. WE HAVE TESTED FOR THE THREE REMAINING CRITERIA: production of comparable disease in the original host species or a related one, re-isolation of the virus, and detection of a specific immune response to the virus. WE INOCULATED TWO MACAQUES WITH VERO-CELL-CULTURED SCV ISOLATED FROM A FATAL SARS CASE, and monitored their clinical signs, virus excretion and antibody response. THE ANIMALS WERE KILLED SIX DAYS POST-INOCULATION (d.p.i.), and we then carried out gross and histopathological examinations of them. Both SCV-inoculated macaques became lethargic from 3 d.p.i. onwards and developed a temporary skin rash, and ONE SUFFERED RESPIRATORY DISTRESS from 4 d.p.i. onwards. The macaques excreted virus from the nose and throat at 2–6 d.p.i., as shown by polymerase chain reaction with reverse transcription (RT-PCR) and by virus isolation (see supplementary information). The isolated virus was identical to that inoculated, as shown by negative-contrast electron microscopy (Fig. 1a) and RT-PCR analysis. Seroconversion to SCV, as determined BY INDIRECT IMMUNOFLUORESCENCE ASSAY USING INFECTED VERO CELLS, was demonstrated in two other SCV-infected macaques at 16 d.p.i.. The virus was also isolated from the faeces of one of these animals (see supplementary information). At gross necropsy, ONE MACAQUE HAD SEVERE MULTIFOCAL PULMONARY CONSOLIDATION, and SCV infection was detected in lung tissue by RT-PCR and virus isolation. Histologically, both macaques had interstitial pneumonia of differing severity. The one with gross lesions had diffuse alveolar damage, marked by necrosis of alveolar and bronchiolar epithelium and flooding of alveolar lumina with proteinaceous fluid, admixed with fibrin, erythrocytes, alveolar macrophages and neutrophils (Fig. 1b). Occasional multinucleated cells (syncytia) were present in the lumen of bronchioles and alveoli (Fig. 1c). These lesions are indistinguishable from those in biopsied lung tissue and in autopsy material from SARS patients5, including the presence of syncytia in alveolar lumina4. SCV thus fulfils all of Koch's postulates as the primary aetiological agent of SARS. THIS DOES NOT EXCLUDE THE POSSIBILITY THAT OTHER PATHOGENS, including human metapneumovirus (hMPV) and Chlamydia pneumoniae, MAY HAVE EXACERBATED THE DISEASE IN SOME SARS PATIENTS. However, these were not present in SCV-inoculated macaques (RESULTS NOT SHOWN), were not found consistently in SARS patients, and do not usually cause the lesions associated with SARS. Moreover, lesions in macaques infected experimentally with hMPV isolated from a non-SARS individual7 were limited to mild suppurative rhinitis and minimal erosion in conducting airways, and disease was not exacerbated in two SCV-infected macaques subsequently inoculated with hMPV (RESULTS NOT SHOWN)." https://www.nature.com/articles/423240a In Summary: -the researchers did not attempt to satisfy Koch's Postulates but instead Rivers modified and watered-down version of them: https://m.facebook.com/story.php?story_fbid=10158168879148576&id=502548575 -thus from the very first paragraph, they invalidate their own fulfillment claim as Rivers 6 Postulates are admittedly different from Koch's 4 Postulates -they then state that the first 3 RIVERS criteria were met by other researchers and referenced the four papers below: PEIRIS: https://m.facebook.com/story.php?story_fbid=10158162232388576&id=502548575 DROSTEN: https://m.facebook.com/story.php?story_fbid=10158164423513576&id=502548575 POUTANEN: https://m.facebook.com/story.php?story_fbid=10158166281663576&id=502548575 KSIAZEK: https://m.facebook.com/story.php?story_fbid=10158168700128576&id=502548575 -Not a single one of these papers could meet the first requirement of Koch's Postulates as they could not find their new "Coronavirus" in every case of the disease. -None of the papers properly purified/isolated any "virus" directly from a sick patient but instead took samples and cultured them in foreign animal cells likely containing added fetal bovine serum, antibiotics, chemicals, nutrients, etc. -Not a single paper gave detailed methods on how they cultured their "viruses" nor attempted to purify and separate the assumed "virus" particles by ultracentrifugation nor filtration even from their cell culture soup. -Every one of the papers admitted to other potential pathogens isolated from SARS cases that could possibly be the causative agent for disease or act as a cofactor in disease progression -the researchers then state that they satisfied the last 3 RIVERS criteria themselves -they used unpurified Vero cell culture supernatant and inoculated two macaques while only observing them for 6 days -only one of the macaques developed respiratory distress -the two macaques had different levels of lung damage at autopsy with one severe and the other one not so -both macaques were lethargic and developed a temporary skin rash, neither of which are main symptoms of SARS: "SYMPTOMS OF SARS In general, SARS begins with a HIGH FEVER (temperature greater than 100.4°F [>38.0°C]). Other symptoms may include HEADACHE, an overall FEELING OF DISCOMFORT, and BODY ACHES. Some people also have MILD RESPIRATORY SYMPTOMS at the outset. About 10 percent to 20 percent of patients have DIARRHEA. After 2 to 7 days, SARS patients may develop a DRY COUGH. Most patients develop PNEUMONIA." https://www.cdc.gov/sars/about/fs-sars.html There can be no claim by this paper as to the fulfillment of Koch's Postulates as they did not even attempt to fulfill them. The WHO, Ron Fouchier, and the other researchers blatantly lied. Instead, they attempted Rivers criteria and even failed at fulfilling his watered-down version as they: 1. did not isolate a "virus" from a diseased host 2. did not cultivate a "virus" in host cells but instead used monkey kidney cells 3. did not provide any proof of filterability 4. did not produce the same disease in an animal host 5. did not re-isolate a "virus" from the animals 6. did not prove that the immune response was specific This paper and the disease associated with it are the shining example of the fraud currently being perpetrated on us by Virology today. For the best insight into the fraud presented in this and other papers, I highly recommend taking 30 minutes out of your day and watching Dr. Andrew Kaufman "The Rooster in the River of Rats:" https://m.youtube.com/watch?v=-Wp_PwYFMyM VAN DER HOEK 2004 CORONAVIRUS HCoV-NL63: These newer "Coronavirus" discoveries highlight the fatal flaws currently dominating Virology: the over reliance on molecular tests and data as proof of "virus" discovery. In this paper, they create their own technique, the VIDISCA method, that they claim can sequence the genome of an unknown "virus." What they don't tell you is that this sequence comes directly from an unpurified monkey kidney cell culture supernatant that was mixed with the nasopharyngeal aspirate from a 7-month old baby. It does not come directly from the sample of a sick patient that has been properly purified/isolated. They claim discovery of a new "Coronavirus" based solely the sequence as there are NO EM IMAGES of any new "Coronavirus," just letters in a database. Bear with me as this is a long one. Highlights below: IDENTIFICATION OF A NEW HUMAN CORONAVIRUS "Three human coronaviruses are known to exist: human coronavirus 229E (HCoV-229E), HCoV-OC43 and severe acute respiratory syndrome (SARS)-associated coronavirus (SARS-CoV). Here we report the identification of a fourth human coronavirus, HCoV-NL63, USING A NEW METHOD OF VIRUS DISCOVERY. The virus was isolated from a 7-month-old child SUFFERING FROM BRONCHIOLITIS AND CONJUNCTIVITIS. The complete genome sequence indicates that this virus is not a recombinant, but rather a new group 1 coronavirus. The in vitro host cell range of HCoV-NL63 is notable BECAUSE IT REPLICATES ON TERTIARY MONKEY KIDNEY CELLS AND THE MONKEY KIDNEY LLC-MK2 CELL LINE. The viral genome contains distinctive features, including a unique N-terminal fragment within the spike protein. Screening of clinical specimens from individuals suffering from respiratory illness identified seven additional HCoV-NL63-infected individuals, indicating that the virus was widely spread within the human population." "To date, THERE IS STILL A VARIETY OF HUMAN DISEASES WITH UNKNOWN ETIOLOGY. A VIRAL ORIGIN HAS BEEN SUGGESTED FOR MANY OF THESE DISEASES, EMPHASIZING THE IMPORTANCE OF A CONTINUOUS SEARCH FOR NEW VIRUSES 1,2,3. Major difficulties are encountered, however, when searching for new viruses. First, SOME VIRUSES DO NOT REPLICATE IN VITRO, at least not in the cells that are commonly used in viral diagnostics. Second, FOR THOSE VIRUSES THAT DO NOT REPLICATE IN VITRO AND CAUSE A CYTOPATHIC EFFECT (CPE), THE SUBSEQUENT VIRUS IDENTIFICATION METHODS MAY FAIL. ANTIBODIES RAISED AGAINST KNOWN VIRUSES MAY NOT RECOGNIZE THE CULTURED VIRUS, AND VIRUS-SPECIFIC PCR METHODS MAY NOT AMPLIFY THE NEW VIRAL GENOME. To solve both problems, we developed a new method for virus discovery based on the cDNA-amplified restriction fragment–length polymorphism technique (cDNA-AFLP4). Here we report the identification of a new coronavirus using this method of Virus-Discovery-cDNA-AFLP (VIDISCA)." "The new coronavirus that we present here was isolated from a child suffering from bronchiolitis and conjunctivitis. THIS WAS NOT AN ISOLATED CASE, AS WE IDENTIFIED THE VIRUS IN CLINICAL SPECIMENS FROM SEVEN ADDITIONAL INDIVIDUALS, both infants and adults, during the last winter season. We also resolved the complete sequence of the viral genome, which revealed several unique features." "Results Virus isolation from a child with acute respiratory disease In January 2003, a 7-month-old child was admitted to the hospital with coryza, conjunctivitis and fever. Chest radiography revealed typical features of bronchiolitis. A nasopharyngeal aspirate specimen was collected 5 d after the onset of disease (sample NL63). Diagnostic tests for respiratory syncytial virus, adenovirus, influenza viruses A and B, parainfluenza virus types 1, 2 and 3, rhinovirus, enterovirus, HCoV-229E and HCoV-OC43 yielded negative results. THE CLINICAL SAMPLE WAS SUBSEQUENTLY INOCULATED ONTO HUMAN FETAL LUNG FIBROBLASTS, TERTIARY MONKEY KIDNEY CELLS (Cynomolgus monkey) AND HeLa CELLS. CPE WAS DETECTED EXTENSIVELY ON TERTIARY MONKEY KIDNEY CELLS, and was first noted 8 d after inoculation. The CPE was diffuse, with a refractive appearance in the affected cells followed by cell detachment. MORE PRONOUNCED CPE WAS OBSERVED UPON PASSAGE ONTO THE MONKEY KIDNEY CELL LINE LLC-MK2, with overall cell rounding and moderate cell enlargement (Supplementary Fig. 1 online). Additional subcultures on human fetal lung fibroblasts, rhabdomyosarcoma cells and Vero cells remained negative for CPE." "Virus discovery by the VIDISCA method IDENTIFICATION OF UNKNOWN PATHOGENS USING MOLECULAR BIOLOGY TOOLS IS DIFFICULT BECAUSE THE TARGET SEQUENCE IS NOT KNOWN, SO GENOME-SPECIFIC PCR PRIMERS CANNOT BE DESIGNED. To overcome this problem, we developed the VIDISCA method based on the cDNA-AFLP technique4. The advantage of VIDISCA is that prior knowledge of the sequence is not required, as the presence of restriction enzyme sites is sufficient to guarantee PCR amplification. The input sample can be either blood plasma or serum, or culture supernatant. Whereas cDNA-AFLP starts with isolated mRNA, VIDISCA begins with a treatment to selectively enrich viral nucleic acid, including a centrifugation step to remove residual cells and mitochondria (Fig. 1a). A DNase treatment is also used to remove interfering chromosomal and mitochondrial DNA from degraded cells (viral nucleic acid is protected within the viral particle). Finally, by choosing frequently cutting restriction enzymes, the method can be fine-tuned such that most viruses will be amplified. We were able to amplify viral nucleic acids in EDTA-treated plasma from a person with hepatitis B viral infection, and from a person with an acute parvovirus B19 infection (Fig. 1b). The technique can also detect HIV-1 in cell culture, demonstrating its capacity to identify both RNA and DNA viruses (Fig. 1b). THE SUPERNATANT OF THE CPE-POSITIVE LLC-MK2 CULTURE NL63 WAS ANALYZED BY VIDISCA. THE SUPERNATANT OF UNINFECTED CELLS WAS USED AS A NEGATIVE CONTROL. After the second PCR amplification step, unique and prominent DNA fragments were present in the test sample but not in the control (1 of 16 selective PCR reactions is shown in Fig. 1c). THESE FRAGMENTS WERE CLONED AND SEQUENCED. Thirteen of 16 fragments showed sequence similarity to members of the coronavirus family, but significant sequence divergence with known coronaviruses was apparent in all fragments, indicating that we had identified a new coronavirus. The sequences of the 13 VIDISCA fragments are provided in Supplementary Figure 2 online." "Detection of HCoV-NL63 in patient specimens To show that HCoV-NL63 originated from the nasopharyngeal aspirate of the child, WE DESIGNED A DIAGNOSTIC RT-PCR THAT SPECIFICALLY DETECTS HCoV-NL63. THIS TEST CONFIRMED THE PRESENCE OF HCoV-NL63 IN THE CLINICAL SAMPLE. The sequence of the RT-PCR product of the 1b gene was identical to that of the virus identified upon in vitro passage in LLC-MK2 cells (DATA NOT SHOWN). Having confirmed that the cultured coronavirus originated from the child, the question remained as to whether this was an isolated clinical case, or whether HCoV-NL63 is circulating in humans. To address this question, WE USED TWO DIAGNOSTIC RT-PCR ASSAYS TO EXAMINE RESPIRATORY SPECIMENS OF HOSPITALIZED INDIVIDUALS AND THOSE VISITING THE OUTPATIENT CLINIC between December 2002 and August 2003 (Fig. 2). WE IDENTIFIED SEVEN ADDITIONAL INDIVIDUALS CARRYING HCoV-NL63 (Table 1). SEQUENCE ANALYSIS OF THE PCR PRODUCTS INDICATED THEY PRESENCE OF A FEW CHARACTERISTIC POINT MUTATIONS IN SEVERAL SAMPLES, SUGGESTING THAT SEVERAL VIRUSES WITH DIFFERENT MOLECULAR MARKERS MAY BE CIRCULATING (Fig. 3 and Supplementary Fig. 3 online). At least five of the HCoV-NL63-positive individuals suffered from respiratory tract illness; the clinical data of two individuals was not available. Including the index case, five of the patients were children less than 1 year old, and three patients were adults. Two adults were likely to be immunosuppressed, as one of them was a bone marrow transplant recipient and the other an HIV-positive patient suffering from AIDS, with very low CD4+ cell counts (Table 1). No clinical data was available for the third adult. ONE PATIENT WAS CONNECTED WITH RESPIRATORY SYNCYTIAL VIRUS (no. 72), AND THE HIV-INFECTED PATIENT (no. 466) CARRIED PNEUMOCYSTIS CARINI. No other respiratory agent was found in the other patients, suggesting that the respiratory symptoms were caused by HCoV-NL63. All positive samples were collected during the last winter season, with a detection frequency of 7% in January 2003. None of the 306 samples collected in the spring and summer of 2003 contained HCoV-NL63 (P < 0.01 by two-tailed t test)." "We next aligned the sequence of HCoV-NL63 with the complete genomes of other coronaviruses. The percentage nucleotide identity was determined for each gene and is listed in Table 2. All genes except the M gene shared the highest identity with HCoV-229E. To confirm that HCoV-NL63 is a new member of the group 1 coronaviruses, we conducted phylogenetic analysis using the nucleotide sequence of the 1a, 1b, S, M and N genes (Fig. 4b). For each gene analyzed, HCoV-NL63 clustered with the group 1 coronaviruses. The 1a, 1b and S genes of HCoV-NL63 are most closely related to those of HCoV-229E. However, further inspection revealed a subcluster of HCoV-NL63, HCoV-229E and PEDV. PHYLOGENETIC ANALYSIS COULD NOT BE PERFORMED FOR THE ORF3 AND E GENES BECAUSE THE REGIONS WERE TOO VARIABLE OR TOO SMALL FOR ANALYSIS, respectively. Bootscan analysis by the Simplot software version 2.5 (ref. 28) found no signs of recombination (data not shown)." "OUR DATA INDICATE THAT HCoV-NL63 CAUSES ACUTE RESPIRATORY DISEASE IN CHILDREN BELOW THE AGE OF 1 YEAR, AND IN IMMUNOCOMPROMISED ADULTS. To date, NO KNOWN VIRAL PATHOGEN CAN BE IDENTIFIED IN A SUBSTANTIAL PORTION OF RESPIRATORY DISEASE CASES IN HUMANS (20–30%; ref. 38). Several assays have been used to diagnose coronavirus infections. Traditionally, an antibody test is implemented to measure a rise in titers of antibodies to the human coronaviruses HCoV-229E or HCoV-OC43 (ref. 12). ANTIBODIES TO HCoV-NL63 MIGHT CROSS-REACT WITH HCoV-229E, given that these viruses are members of the same serotype. If this were the case, HCoV-NL63 INFECTIONS MIGHT HAVE BEEN MISDIAGNOSED AS HCoV-229E. Molecular biology tools such as RT-PCR assays 39,40 were designed to selectively detect the human coronaviruses HCoV-229E and HCoV-OC43, but these assays will not detect HCoV-NL63. EVEN THE RT-PCR ASSAY THAT WAS DESIGNED TO AMPLIFY ALL KNOWN CORONAVIRUSES 40 IS NOT ABLE TO AMPLIFY HCoV-NL63 BECAUSE OF SEVERAL MISMATCHES WITH THE PRIMER SEQUENCES. The availability of the complete HCoV-NL63 genome sequence means that these diagnostic assays can be substantially improved." "FUTURE EXPERIMENTS WITH MORE SENSITIVE DIAGNOSTIC TOOLS SHOULD YIELD A MORE ACCURATE PICTURE OF THE PREVALENCE OF THIS VIRUS AND ITS ASSOCIATION WITH RESPIRATORY DISEASE." METHODS (found in Supplementary Material) "THE ORIGINAL NASOPHARYNGEAL ASPIRATE WAS INOCULATED ONTO A VARIETY OF CELLS. The cultures were kept in a rollerdrome at 34°C and inspected by eye every 3 to 4 days. MAINTENANCE MEDIUM WAS REPLENISHED EVERY 3 TO 4 DAYS. TWO DIFFERENT TYPES OF MEDIUM WERE USED: Optimem 1 (Invitrogen, Breda, The Netherlands) without bovine fetal serum was used for the tMK cells, and MEM Hanks’ /Earle’s medium (Invitrogen, Breda, The Netherlands) WITH 3% BOVINE FETAL SERUM FOR THE REMAINING CELL TYPES." https://www.nature.com/articles/nm1024#MOESM5 In Summary (Part 1): -the researchers created their own method known as VIDISCA to sequence a new "Coronavirus -the "virus" came from a 7-month-old infant suffering bronchitis and conjunctivitis -the "virus" was "isolated" from the unpurified mixture of the infants nasopharyngeal aspirate and tertiary monkey kidney cells -they admit that the cause of many respiratory diseases remain unknown and that "viruses" are the presumed cause thus the need to hunt for new "viruses" -they state that there are two main problems searching for new "viruses:" 1. Some "viruses" do not culture in cells in vitro 2. For these "viruses" that do not replicate nor cause CPE, "virus" identification methods such as antibody and PCR may fail -cells lines such as human fetal lung fibroblasts, tertiary monkey kidney, and HeLa cells were used for culturing -tertiary monkey cells saw the most extensive CPE out of all and even more CPE was observed once it was passaged into the LLC-MK2 monkey kidney cells -they admit that using molecular tools to find unknown "viruses" is difficult since the target sequence is unknown and genome-specific PCR primers can not be designed -the supernatant of LLC-MK2 was examined by VIDISCA and uninoculated cell cultures were used as a "control" -they developed their own PCR test to detect the sequence they created from the supernatant of the LLC-MK2 cell culture in clinical samples -they then used their own PCR to test clinical samples from 2002-2003 to find 7 more "positive" cases in order to show that their "discovery" was not an isolated incident -several characteristic mutations were found in the 7 samples suggesting multiple "viruses" with different molecular markers were in circulation -2 of the 7 cases were immunocompromised adults: one a bone-marrow transplant recipient and the other an HIV patient with pneumocystis carinii -their data shows that NL63 affects infants under 1 and immunocompromised adults -antibodies for HL63 might cross-react with 229E -PCR primer used to identify all "Coronaviruses" can not detect NL63 due to several mismatches with the primer sequence -they leave it to future experiments with better technology to get a more accurate idea as to NL63's prevalence and association with respiratory disease -the NP swab was inoculated on many cells and media was replenished every 3-4 days -two different media were used during the culturing process As can be seen, these researchers discovered nothing more than letters in a database. They created a sequence using their own VIDISCA program from unpurified cell culture supernatant mixed with a sample from an infant.They fabricated cases by combing through old clinical samples utilizing their own "diagnostic" PCR. There aren't even any accompanying EM images of this new "Coronavirus." Everything relating to NL63 depends on how accurate their VIDISCA method is and whether or not it can actually sequence unknown "viruses." This is from the same researchers describing the limitations of their VIDISCA method in 2011, seven years after their "discovery" of HCoV-NL63 using this method: "Virus discovery cDNA-AFLP (VIDISCA) is a virus discovery method based on recognition of restriction enzyme cleavage sites, ligation of adaptors and subsequent amplification by PCR. However, DIRECT DISCOVERY OF UNKNOWN PATHOGENS IN NASOPHARYNGEAL SWABS IS DIFFICULT DUE TO THE HIGH CONCENTRATION OF RIBOSOMAL RNA (rRNA) THAT ACTS AS COMPETITOR." "THESE CONDITIONS ARE GENERALLY ONLY MET WHEN VIRUS CULTURE SUPERNATANT IS USED. IN CLINICAL RESPIRATORY SAMPLES LIKE NASOPHARYNGEAL SWABS IN UNIVERSAL TRANSPORT MEDIUM (UTM) VARIOUS AMOUNTS OF COMPETITOR RNA/DNA FROM DISRUPTED CELLS/BACTERIA CAN BE PRESENT. Ribosomal RNA, which is ~80% of the total cellular RNA, is one of the biggest problems due to its high copy number and its stability within ribosomes. IN PARTICULAR RNA VIRUSES ARE DIFFICULT TO DISCOVER SINCE IN THESE CASES A REVERSE TRANSCRIPTION IS NEEDED, WHICH WILL ENABLE rRNA TO ACT AS COMPETITION NUCLEIC ACID SEQUENCES." "RESPIRATORY SAMPLES CONTAIN NON-VIRAL NUCLEIC ACIDS THAT INTERFERE IN VIRUS DISCOVERY TECHNIQUES LIKE VIDISCA. It is relatively easy to decrease the influence of background bacterial or human DNA and mRNA by centrifugation and DNase/RNase treatment, BUT RIBOSOMAL RNA (rRNA) IS DIFFICULT TO ELIMINATE BECAUSE THE RIBOSOMAL PROTEINS PROTECTS THE rRNA INSIDE THE RIBOSOMES." "Sequence independent amplification methods, such as VIDISCA and random-PCR, can identify viral sequences without prior knowledge of a viral genome. Unfortunately, THE DETECTION OF UNKNOWN VIRAL PATHOGENS IN RESPIRATORY CLINICAL MATERIAL IS DIFFICULT with these sequence independent virus discovery methods BECAUSE OF LOW VIRAL LOAD AND HIGH BACKGROUND NUCLEIC ACIDS IN THESE SAMPLES. During the last years sequence independent virus discovery techniques WERE MOSTLY USED WITH VIRUS CULTURE SUPERNATANT, as they contain high concentrations of viral genomes [6,12], or to discover previously unknown DNA viruses [13-15]. SO FAR NO STUDY HAS BEEN ABLE TO IDENTIFY NOVEL HUMAN RESPIRATORY RNA VIRUSES WITH SEQUENCE INDEPENDENTLY AMPLIFICATION TECHNIQUES. Thus sequence independent amplification techniques like VIDISCA HAVE TO BE OPTIMIZED TO ALLOW DISCOVERY WITHOUT REQUIRING A CULTURE AMPLIFICATION STEP." "WE ALSO OBSERVED THE PRESENCE OF UNKNOWN SEQUENCES WITHIN OUR DATA SET. IT COULD BE THAT THESE SEQUENCES ARE DERIVED FROM YET UNKNOWN VIRUSES, OR IT COULD BE THAT THE SEQUENCES ARE PART OF A GENOMIC SEQUENCE FROM A KNOWN ORGANISM, e.g. a bacterium of which not the complete genomic sequence is present in the Genbank databases. THUS CARE SHOULD BE TAKEN TO ASSIGN SEQUENCES AS POTENTIALLY VIRAL, SINCE SO MANY ORGANISMS HAVE NOT BEEN FULLY SEQUENCED." https://journals.plos.org/plosone/article?id=10.1371%2Fjournal.pone.0016118 In Summary (Part 2): -direct discovery of unknown pathogens in NP swabs is difficult due to ribosomal RNA acting as a competitor -conditions are only met when "virus" culture supernatant is used -transport media used to carry NP swabs contains various DNA/RNA from disrupted cells/bacteria -RNA "viruses" are difficult as reverse-transcriptase is needed which enables rRNA to act as competition nucleic acid sequences -respiratory samples contain "non-viral" nucleic acid which interferes with VIDISCA -ribosomal RNA is difficult to eliminate -discovering unknown "viruses" from respiratory samples is difficult due to low "viral load" and high nucleic acid background in samples -so far, NO STUDY has been able to identify novel human respiratory RNA "viruses" using sequence independently amplification techniques such as VIDISCA -VIDISCA would have to be optimized to discover novel "viruses" without cell culture -they observed unknown sequences in their data that could be unknown "viruses" or from genome sequences of known organisms -sequences should be labelled "POTENTIALLY VIRAL' since so many sequences remain unknown for most organisms Reading this review of their own VIDISCA system seven years after they "discovered" NL63 doesn't make the technology nor their finding sound all that accurate, does it? But wait, there's more! Here is some additional insight into the VIDISCA methods used: "The authors state that “the identification of unknown pathogens using molecular biology tools is difficult because the target sequence is not known so that PCR-specific initiators cannot be designed“. WHAT THEY USED IS A TOOL THEY DEVELOPED THEMSELVES CALLED VIDISCA which, they claim, does not require prior knowledge of the sequence! Is that possible? Let’s see how it works: FIRST THE CULTURE IS PREPARED AND IT IS ASSUMED THAT A VIRUS IS PRESENT DUE TO THE EVIDENCE OF “CYTOPATHIC EFFECT”. The novelty introduced by this method is that “restriction enzymes” are added, enzymes that cut the nucleic acid molecules at certain locations and always by the same length. In this way, if after the action of these enzymes they observe many fragments of DNA or RNA that are the same or very similar, THEY DEDUCE THAT IT COMES FROM A VIRUS, since the host genome would present random cuts, while the virus genome presents a large number of copies that are the same due to the replication of the virus. And is such a deduction correct? Of course not! THIS ASSUMPTION (which adds to the previous assumption that there is a virus) DOES NOT TAKE INTO ACCOUNT THAT THERE ARE “VIRUS-LIKE PARTICLES”, “RETROVIRUS-LIKE PARTICLES”, “ENDOGENOUS RETROVIRUSES”, “EXOSOMES”, “EXTRACELLULAR” PARTICLES AND EVEN MITOCHONDRIAL DNA. In denial, THERE ARE A MULTITUDE OF PARTICLES THAT POSSESS THE SAME REPRODUCTIVE CHARACTERISTICS IN LARGE QUANTITIES AS “VIRUSES” AND THEREFORE CAN FALSIFY RESULTS BY PRODUCING LARGE NUMBERS OF IDENTICAL COPIES when cut by enzymes as recognised in an article on the VIDISCA technique entitled Enhanced bioinformatic proSling of VIDISCA libraries for virus detection and Discovery. It was published in volume 263 of Virus Research on April 2, 2019, and its authors-Cormac M. Kinsella et al.-recognise that “NO REDUNDANCY IS EXPECTED IN THE VIDISCA INSERT FROM THE HOST BACKGROUND NUCLEIC ACID EXCEPT IN THE CASE OF ‘VIRUS-LIKE’ CHARACTERISTICS, i.e., high copy numbers as in mitochondrial DNA.” https://principia-scientific.com/confirmed-pcr-tests-cannot-detect-sars-cov-2-cause-of-covid19 Once again for emphasis: "NO REDUNDANCY IS EXPECTED IN THE VIDISCA INSERT FROM THE HOST BACKGROUND NUCLEIC ACID EXCEPT IN THE CASE OF "VIRUS-LIKE" CHARACTERISTICS" Creating their own technology which can not do what they state it can in order to claim the indirect discovery of a new "virus" with nothing physical backing it up, just a bunch of A's, C's, T's, and G's in a computer database. This is the SCAM called Molecular Virology. WOO 2005 CORONAVIRUS HKU1 PAPER: Over the years, I have read a lot of bad "virus" papers. This one for the "discovery" of HKU1 may just take the top spot on that list...which is no easy task. I won't spoil it here and will let the highlights speak for themselves. CHARACTERIZATION AND COMPLETE GENOME SEQUENCE OF A NOVEL CORONAVIRUS, CORONAVIRUS HKU1, FROM PATIENTS WITH PNEUMONIA "DESPITE EXTENSIVE LABORATORY INVESTIGATIONS in patients with respiratory tract infections, NO MICROBIOLOGICAL CAUSES CAN BE IDENTIFIED IN A SIGNIFICANT PROPORTION OF PATIENTS." "Here we report the discovery of another novel coronavirus, coronavirus HKU1 (CoV-HKU1), FROM A SEVENTY ONE-YEAR-OLD MAN WITH PNEUMONIA who had just returned from Shenzhen, China. Quantitative reverse transcription-PCR showed that the amount of CoV-HKU1 RNA was 8.5 to 9.6 × 106 copies per ml in his nasopharyngeal aspirates (NPAs) during the first week of the illness and dropped progressively to undetectable levels in subsequent weeks. He developed increasing serum levels of specific antibodies against the recombinant nucleocapsid protein of CoV-HKU1, with immunoglobulin M (IgM) titers of 1:20, 1:40, and 1:80 and IgG titers of <1:1,000, 1:2,000, and 1:8,000 in the first, second and fourth weeks of the illness, respectively. ISOLATION OF THE VIRUS BY USING VARIOUS CELL LINES, MIXED NEURON-GLIA CULTURE, AND INTRACEREBRAL INOCULATION OF SUCKLING MICE WAS UNSUCCESSFUL." "SINCE NO MICROBIOLOGICAL CAUSE CAN BE IDENTIFIED FOR A SIGNIFICANT PROPORTION OF PATIENTS WITH RESPIRATORY TRACT INFECTIONS (18, 29), research has been conducted to identify novel agents." "In this study, we report the discovery of a novel group 2 coronavirus IN THE NASOPHARYNGEAL ASPIRATES (NPAs) OF PATIENTS WITH PNEUMONIA. The complete genome of the coronavirus was sequenced and analyzed. Based on the findings of this study, we propose that this new virus be designated coronavirus HKU1 (CoV-HKU1)." "RNA extraction.Viral RNA WAS EXTRACTED FROM THE NPA, URINE, AND FECAL SPECIMENS by using the QIAamp Viral RNA Mini kit (QIAgen, Hilden, Germany). The RNA pellet was resuspended in 10 μl of DNase-free, RNase-free double-distilled water and was used as the template for RT-PCR." "Complete genome sequencing and genome analysis.The complete genome of CoV-HKU1 was amplified and sequenced BY USING THE RNA EXTRACTED FROM THE NPAs AS A TEMPLATE. The RNA was converted to cDNA by a combined RANDOM-PRIMING and oligo(dT) priming strategy." "SEQUENCES WERE ASSEMBLED AND MANUALLY EDITED TO PRODUCE A FINAL SEQUENCE OF THE VIRAL GENOME. The nucleotide sequence of the genome and the deduced amino acid sequences of the open reading frames (ORFs) WERE COMPARED TO THOSE OF OTHER CORONAVIRUSES. Phylogenetic tree construction was performed by using the PileUp method with GrowTree (Genetics Computer Group, Inc.). Prediction of signal peptides and their cleavage sites was performed by using SignalP (21). Protein family analysis was performed by using PFAM and InterProScan (1, 2). Prediction of transmembrane domains was performed by using TMpred and TMHMM (11, 32). PHDhtm WAS ALSO USED WHEN THERE WAS DISAGREEMENT BETWEEN THE RESULTS OBTAINED BY USING TMpred AND TMHMM (3). Potential N-glycosylation sites were predicted by using ScanProsite (7)." "RESULTS Index patient and microbiological tests.A 71-year-old Chinese man was admitted to hospital in January 2004 because of fever and productive cough with purulent sputum for 2 days. HE HAD A HISTORY OF PULMONARY TUBERCULOSIS more than 40 years ago complicated by cicatrization of the right upper lobe and bronchiectasis with chronic Pseudomonas aeruginosa colonization of airways. HE WAS A CHRONIC SMOKER AND ALSO HAD CHRONIC OBSTRUCTIVE AIRWAY DISEASE, HYPERLIPIDEMIA, AND ASYMPTOMATIC ABDOMINAL AORTIC ANEURYSM. He had just returned from Shenzhen, China, 3 days before admission. A chest radiograph showed patchy infiltrates over the left lower zone. NPA for direct antigen detection of respiratory viruses, RT-PCR of influenza A virus, human metapneumovirus, and SARS-CoV, and viral cultures were negative. AFTER THE VIRUS WAS DETERMINED TO BE A CORONAVIRUS, THE NPAs WERE INOCULATED INTO RD (human rhabdomyosarcoma), I13.35 (murine macrophage), L929 (murine fibroblast), HRT-18 (colorectal adenocarcinoma), AND B95a (marmoset B-lymblastoid) CELL LINES AND MIXED NEURON-GLIA CULTURE. NO CYTOPATHIC EFFECT WAS OBSERVED. QUANTITATIVE RT-PCR, USING THE CULTURE SUPERNATANTS AND CELL LYSATES TO MONITOR THE PRESENCE OF VIRAL REPLICATION, ALSO SHOWED NEGATIVE RESULTS. MOREOVER, INTRACEREBRALLY INOCULATED SUCKLING MICE REMAINED HEALTHY AFTER 14 days. SPUTUM WAS NEGATIVE FOR BACTERIAL AND MYCOBACTERIAL PATHOGENS. Paired sera for antibodies against Mycoplasma, Chlamydia, Legionella, and SARS-CoV were negative. His symptoms improved, and he was discharged after 5 days of hospitalization.`` "DISCUSSION We report the characterization and complete genome sequence of a novel coronavirus detected in the NPAs of patients with pneumonia." "THE FACT THAT THE PRESENT VIRUS COULD NOT BE RECOVERED FROM CELL CULTURES COULD BE RELATED TO THE LACK OF A SUSCEPTIBLE CELL LINE FOR CoV-HKU1 OR THE INHERENTLY LOW RECOVERY RATE OF SOME CORONAVIRUSES. Many decades after the recognition of HCoV-229E and HCoV-OC43, the other non-SARS human respiratory coronaviruses known to cause pneumonia at low frequencies (27, 35, 40), THERE ARE STILL ONLY A FEW PRIMARY VIRUS ISOLATES AVAILABLE, and organ culture is required for primary isolation of HCoV-OC43. In our experience, SARS-CoV CAN BE RECOVERED ONLY FROM LESS THAN 20% OF PATIENTS with serologically and RT-PCR-documented SARS-CoV pneumonia. After the discovery of CoV-HKU1 in the index patient, we conducted a preliminary study on 400 NPAs that were collected last year during the SARS period. Among these 400 NPAs, CoV-HKU1 WAS DEFECTED IN ONE SPECIMEN, with a viral load comparable to that of the index patient. THESE RESULTS SUGGESTED THAT CoV-HKU1 IS NOT ONLY AN INCIDENTAL FINDING IN AN ISOLATED PATIENT BUT A PREVIOUSLY UNRECOGNIZED CORONAVIRUS ASSOCIATED WITH PNEUMONIA." "THE PREVALENCE OF CoV-HKU1 IN HUMANS AS A CAUSE OF RESPIRATORY TRACT INFECTIONS REMAINS TO BE DETERMINED." "FURTHER CLINICAL, SEROEPIDEMIOLOGICAL, AND PHYLOGENETIC STUDIES WOULD BE REQUIRED TO DETERMINE THE RELATIVE IMPORTANCE OF CoV-HKU1 compared to other respiratory tract viruses in causing upper and lower respiratory tract infections, its seroprevalence, and the origin of the virus." https://jvi.asm.org/content/79/2/884 In Summary: -they start off by admitting that despite extensive laboratory investigations, the cause of respiratory disease for many patients remains unknown as no microbiological causes can be identified -they report the discovery of HKU1 based on one 71 year old man with pneumonia -isolation of the "virus" by culturing in various cell lines, mixed neuron-glia cultures, and through intracerebral inoculation of suckling mice were all UNSUCCESSFUL -RNA was taken from NP swabs, urine, and feces -RNA extracted from the unpurified nasopharyngeal aspirate was used as a template to create the genome and was converted to cDNA by a combined RANDOM-PRIMING and oligo(dT) priming strategy -sequences were assembled and manually edited to produce the final "virus" genome -they used "Coronavirus" specific PCR assays and compared their genome to "Coronavirus" genomes -they used various prediction programs and if there was disagreement, they would use another to resolve it -the 71 year old man, whom they "isolated" this new "Coronavirus" from, had a history of RESPIRATORY disease having had tuberculosis, being a chronic smoker, and having chronic obstructive airway disease, hyperlipidemia, and asymptomatic abdominal aortic aneurysm -as stated before, no "virus" was cultured, no CPE was observed, quantitative RT-PCR results were negative, mice inoculated intracerebrally remained healthy, and his sputum was negative for bacterial and mycobacterial pathogens -he recovered and was released 5 days later -they then attempt to make excuses for why they were unable to isolate a "virus" from cell cultures such as lack of susceptible cell line or the inherently low recovery rate of "Coronaviruses" -they admit that "SARS-COV-1" can only be "isolated" from less than 20% of patients -they then tested 400 swabs collected during the SARS epidemic and found one that matched their HKU1 sequence -they concluded that despite the lack of "virus" from the 71 year old man and with the 1 positive result out of 400 from old SARS cases, this was proof enough that HKU1 was not an isolated incident -they then state that the prevalence of HKU1 as a cause of respiratory disease was yet to be determined and that further clinical, seroepidemiological, and phylogenetic studies would be required to determine the importance of HKU1 No CPE observed, no "virus" was isolated from numerous cell and mixed neuron-glia cultures, quantitative RT-PCR results for "viral" replication were negative, the intracerebrally inoculated suckling mice remained healthy, no EM images were obtained, and the sample size was one 71 year old man with a history of respiratory disease....where is the proof of a new "Coronavirus" again? ZAKI 2012 MERS CORONAVIRUS PAPER: Remember the horrendous MERS "Coronavirus" outbreak of 2012? Yeah, me neither. Maybe it was the fact that there were only 882 deaths associated with it globally? Or the fact that the "virus" didn't like to travel as 804 of those deaths were in Saudi Arabia? Or maybe it's because there has been no MERS "outbreak" since? Maybe the lack of evidence for the MERS "virus" is the best place to start. Highlights below: ISOLATION OF A NOVEL CORONAVIRUS FROM A MAN WITH PNEUMONIA IN SAUDI ARABIA "Case Report A 60-YEAR-OLD SAUDI MAN was admitted to a private hospital in Jeddah, Saudi Arabia, on June 13, 2012, with a 7-day history of fever, cough, expectoration, and shortness of breath. He had no history of cardiopulmonary or renal disease, was receiving no long-term medications, and did not smoke. The physical examination revealed a body-mass index (the weight in kilograms divided by the square of the height in meters) of 35.1, a blood pressure of 140/80 mm Hg, a pulse of 117 beats per minute, a temperature of 38.3°C, and a respiratory rate of 20 breaths per minute." "On day 1, treatment was started with oseltamivir, levofloxacin, piperacillin–tazobactam, and micafungin. On day 4, treatment with meropenem was started, SINCE KLEBSIELLA PNEUMONIAE THAT WAS SENSITIVE TO MEROPENEM WAS DETECTED ON BRONCHOSCOPY AND TRACHEAL LAVAGE PERFORMED ON DAY 2. STAPHYLOCOCCUS AUREUS, which was sensitive to a wide range of antimicrobials, WAS COLLECTED FROM A SPUTUM SAMPLE COLLECTED ON ADMISSION. ACINETOBACTER WAS DETECTED IN A TRACHEAL ASPIRATE SAMPLE COLLECTED ON THE DAY OF DEATH. No other pathogens were detected in respiratory specimens, and no bacterial growth was detected from blood samples." "The patient tested negative for the human immunodeficiency virus; TESTING WAS NOT PERFORMED FOR PNEUMOCYSTIS PNEUMONIA." "On day 11 after admission (June 24, 2012), the patient died of progressive respiratory and renal failure. A POSTMORTEM EXAMINATION WAS NOT PERFORMED." "Methods CLINICAL SPECIMENS AND VIRAL CULTURE Blood samples were collected in vacutainers with and without EDTA. SPUTUM SAMPLES WERE COLLECTED IN STERILE CUPS, AFTER WHICH VIRUS TRANSPORT MEDIUM WAS ADDED; samples were stirred and centrifuged at 2000 rpm for 10 minutes. Supernatant was transferred to a new sterile tube and USED TO INOCULATE VERO AND LLC-MK2 CELLS by adsorption for 1 hour at room temperature, AFTER WHICH 2% FETAL BOVINE SERUM IN MINIMAL ESSENTIAL MEDIUM EAGLE WAS ADDED. Flasks were incubated in a carbon dioxide incubator at 37°C and observed daily for 15 days for cytopathic changes WITH CHANGE OF MEDIUM EVERY 3 DAYS." "The day 1 sputum sample tested negative by indirect immunofluorescence assays for influenza A and B viruses, parainfluenza viruses types 1 to 3, respiratory syncytial virus, and adenovirus. However, for a sputum sample obtained on admission, inoculation in LLC-MK2 and Vero cells RESULTED IN CYTOPATHIC CHANGES SUGGESTIVE OF VIRUS REPLICATION (Figure 2A). Cytopathic changes consisted of syncytium formation in LLC-MK2 cells at low pH and rounding and detachment of cells at neutral or alkaline pH in Vero and LLC-MK2 cells. On passage of the culture supernatant to fresh cells, the same cytopathic effects were observed within 5 days. Virus was not isolated from a blood sample collected on admission or from a tracheal aspirate sample collected 4 days after admission. Indirect immunofluorescence assays for the detection of influenza A and B viruses, parainfluenza viruses types 1 to 3, respiratory syncytial virus, and adenovirus were performed with the infected cell cultures, but again with negative results. In contrast, when these slides were incubated with serum samples collected from the patient 10 and 11 days after admission, the samples reacted strongly when dilutions of 1:20 were tested on immunofluorescence assay specific for IgG antibodies. NO ATTEMPTS WERE MADE TO DETECT VIRUS-SPECIFIC IgM ANTIBODIES. In contrast, 2400 control serum samples collected from persons seeking medical attention at the Dr. Soliman Fakeeh Hospital in Jeddah from 2010 through 2012 remained negative in this assay. THESE DATA SUGGESTED THAT ANTIBODIES TO AN UNKNOWN VIRUS HAD DEVELOPED IN THE PATIENT, although such antibodies were not detectable in the general population over the previous 2 years. Real-time PCR assays specific for adenovirus, enterovirus, human metapneumovirus, and human herpesvirus types 1 to 3 yielded negative results with the use of nucleic acids extracted from the inoculated cell-culture supernatants. Furthermore, family-wide PCR assays that can detect all known paramyxoviruses 6,7 also yielded negative results. However, FAMILY-WIDE PCR ASSAYS FOR THE DETECTION OF CORONAVIRUSES 3,8 YIELDED PCR FRAGMENTS OF THE EXPECTED SIZES." "The PCR fragments of the pan-coronavirus PCR3 were sequenced. This sequence corresponded with a conserved region of open reading frame 1b of the replicase gene of a coronavirus. REFERENCE CORONAVIRUS GENOME SEQUENCES WERE DOWNLOADED FROM GenBank AND ALIGNED WITH THE AMPLIFIED FRAGMENT OF THE NEWLY DISCOVERED VIRUS, hereafter called HCoV-EMC (for Erasmus Medical Center). A maximum-likelihood tree was constructed to infer the phylogenetic relationships (Figure 2B)." "Discussion THE FIRST DECADE OF THE 21st CENTURY HAS WITNESSED AN INCREASE IN THE NUMBER OF CORONAVIRUSES THAT HAVE BEEN IDENTIFIED, along with a corresponding increase in the number of coronavirus genomes that have been sequenced. Such increases were due to the discovery of the SARS coronavirus, which resulted in a global outbreak of pneumonia in 2003 that affected persons in approximately 30 countries and resulted in about 800 deaths.12 BEFORE 2003, ONLY TWO HUMAN CORONAVIRUSES WERE KNOWN, HCoV-229E and HCoV-OC43, both discovered in the 1960s.13,14 After the emergence of the SARS-CoV in 2003, two additional human coronaviruses were discovered, HCoV-NL63 and HCoV-HKU1.15-17 HERE WE REPORT THE ISOLATION AND CHARACTERIZATION OF THE SIXTH CORONAVIRUS THAT APPARENTLY MAY INFECT HUMANS." "As compared with other coronaviruses, HCoV-EMC WAS ISOLATED AND PROPAGATED RELATIVELY EASILY IN VERO AND LLC-MK2 CELLS. The only other human coronaviruses that replicate well in these monkey-cell lines are SARS-CoV and HCoV-NL63, which both use human angiotensin-converting enzyme 2 as their receptor. We hypothesize that one or more species of animals, possibly bats, were the reservoir host of this new coronavirus. Saudi Arabia harbors numerous bat species, including pipistrellus bats, which were found to carry BatCoV-HKU5 in Asia." "Three months after the hospitalization of the patient in Jeddah, it was reported that a second patient with a history of travel to Saudi Arabia who had been transferred from a hospital in Qatar to a hospital in London was infected with the same virus.25 AT PRESENT, LINKS BETWEEN THE TWO INFECTED PATIENTS OR A POTENTIAL COMMON SOURCE OF INFECTION HAVE NOT BEEN IDENTIFIED. NO ADDITIONAL CASES HAVE BEEN IDENTIFIED, although several are still under investigation. Epidemiologic investigations, active case findings with the use of updated case definitions,25 and syndrome surveillance in combination with sensitive diagnostic tests will be key to monitoring the present situation and — if necessary — to intervene in a potential outbreak. IT WILL BE EQUALLY IMPORTANT TO TEST WHETHER HCoV-EMC FULFILLS KOCH'S POSTULATES AS THE CAUSATIVE AGENT OF SEVERE RESPIRATORY DISEASE." https://www.nejm.org/doi/full/10.1056/nejmoa1211721 In Summary: -they never tested whether MERS fulfills Koch's Postulates in order to prove it is a causative agent of severe respiratory disease END OF SUMMARY. Just kidding (but not really...). -MERS is based on the case of one 60 year old man -Klebsiella Pneumoniae, Staphylococcus Aureus, and Acinetobacter were detected in the patient -testing for Pneumocystis Pneumonia was not performed -a postmortem examination was not performed -sputum samples were placed into viral transport media and cultured in Vero and LLC-MK2 cells with FBS and MEME, which were replaced every 3 days -they saw CPE SUGGESTIVE of "viral" replication -No attempts were made to detect "virus-specific" IgM antibodies yet their data SUGGESTED that antibodies to an unknown "virus" were present -PCR assays designed for "Coronavirus" shockingly (note sarcasm) yielded fragments of "Coronavirus" size -"Coronavirus" reference genome sequences were downloaded and aligned with the "new" fragment -they admit that the first decade of the 21st century has seen an increase in "Coronaviruses" discovered with there having been only 2 "Coronaviruses" from the 1960's to 2003 -they report the "isolation" and characterization of a "Coronavirus" that APPARENTLY MAY infect humans -they claim there was another patient infected with the "virus" but no link between the two patients nor a common infection source could be determined -no other cases had been reported So there you have it. MERS is based on one 60 year old patient. There were no EM images of a new "Coronavirus." They never fulfilled Koch's Postulates to prove it is a causative agent of severe respiratory disease. End of story ZHOU 2020 "SARS-COV-2" PAPER: It is clear after having gone through the history of "Coronaviruses" from 1965 up to today, not a single one of these so-called "viruses" has ever been properly purified/isolated directly from a sick patient nor proven pathogenic by fulfilling Koch's Postulates. They always take the fluid from a sick patient and mix it with animal cells (usually from an African Green Monkey Kidney called Vero cells) along with a combination of antibiotics/antifungals, fetal bovine serum, "nutrients," and other chemicals. Even from this concoction, which can hardly be called an isolation of anything, they never purify any "virus" particles. Sometimes they take EM images directly from the cell culture supernatant which contains potentially billions of similar looking particles. They never prove pathogenicity in a natural way in animal models. This is as true today with "SARS-COV-2" as it was in 1965 with the forgotten B814. Highlights below from one of the first "SARS-COV-2" studies: A PNEUMONIA OUTBREAK ASSOCIATED WITH A NEW CORONAVIRUS OF PROBABLE BAT ORIGIN "Here we report the identification and characterization of a new coronavirus (2019-nCoV), which caused an epidemic of acute respiratory syndrome in humans in Wuhan, China. The epidemic, which started on 12 December 2019, had caused 2,794 laboratory-confirmed infections including 80 deaths by 26 January 2020. Full-length genome sequences were obtained from five patients at an early stage of the outbreak. THE SEQUENCES ARE ALMOST IDENTICAL AND SHARE 79.6% SEQUENCES IDENTITY TO SARS-CoV. Furthermore, we show that 2019-nCoV is 96% IDENTICAL AT THE WHOLE-GENOME LEVEL TO A BAT CORONAVIRUS." "THE DISEASE WAS DETERMINED TO BE CAUSED BY VIRUS-INDUCED PNEUMONIA BY CLINICIANS ACCORDING TO CLINICAL SYMPTOMS AND OTHER CRITERIA, including a rise in body temperature, decreases in the number of lymphocytes and white blood cells (although levels of the latter were sometimes normal), new pulmonary infiltrates on chest radiography AND NO OBVIOUS IMPROVEMENT AFTER TREATMENT WITH ANTIBIOTICS FOR THREE DAYS." "Samples from seven patients with severe pneumonia (six of whom are sellers or delivery men from the seafood market), who were admitted to the intensive care unit of Wuhan Jin Yin-Tan Hospital at the beginning of the outbreak, were sent to the laboratory at the Wuhan Institute of Virology (WIV) for the diagnosis of the causative pathogen (Extended Data Table 1). As a laboratory investigating CoV, WE FIRST USED PAN-COV PCR PRIMERS TO TEST THESE SAMPLES 13, given that the outbreak occurred in winter and in a market—the same environment as SARS infections. WE FOUND FIVE SAMPLES TO BE PCR-POSITIVE FOR CoVs. ONE SAMPLE (WIV04), COLLECTED FROM THE BRONCHOALVEOLAR LAVAGE FLUID (BALF), WAS ANALYSED BY METAGENOMICS ANALYSIS USING NEXT-GENERATION SEQUENCING TO IDENTIFY POTENTIAL ASTROLOGICAL AGENTS. Of the 10,038,758 total reads—of which 1,582 total reads were retained after filtering of reads from the human genome—1,378 (87.1%) sequences matched the sequence of SARSr-CoV (Fig. 1a). By de novo assembly and targeted PCR, we obtained a 29,891-base-pair CoV genome that shared 79.6% sequence identity to SARS-CoV BJ01 (GenBank accession number AY278488.2). HIGH GENOME COVERAGE WAS CONTAINED BY REMAPPING THE TOTAL READS TO THIS GENOME (Extended Data Fig. 1)." "WE THEN FOUND THAT A SHORT REGION OF RNA-DEPENDENT RNA POLYMERASE (RdRp) FROM A BAT CORONAVIRUS (BatCoV RaTG13)—which was previously detected in Rhinolophus affinis from Yunnan province—SHOWED HIGH SEQUENCE IDENTITY TO 2019-nCoV. We carried out full-length sequencing on this RNA sample (GISAID accession number EPI_ISL_402131). SIMPLOT ANALYSIS SHOWED THAT 2019-nCoV WAS HIGHLY SIMILAR THROUGHOUT THE GENOME TO RaTG13 (Fig. 1c), WITH AN OVERALL GENOME SEQUENCE IDENTITY OF 96.2%. Using the aligned genome sequences of 2019-nCoV, RaTG13, SARS-CoV and previously reported bat SARSr-CoVs, no evidence for recombination events was detected in the genome of 2019-nCoV. Phylogenetic analysis of the full-length genome and the gene sequences of RdRp and spike (S) showed that—for all sequences—RaTG13 IS THE CLOSEST RELATIVE OF 2019-nCoV and they form a distinct lineage from other SARSr-CoVs (Fig. 1d and Extended Data Fig. 2). The receptor-binding spike protein encoded by the S gene was highly divergent from other CoVs (Extended Data Fig. 2), with less than 75% nucleotide sequence identity to all previously described SARSr-CoVs, EXCEPT FOR A 93.1% NUCLEOTIDE IDENTITY TO RaTG13 (Extended Data Table 3). The S genes of 2019-nCoV and RaTG13 are longer than other SARSr-CoVs." "THE CLOSE PHYLOGENETIC RELATIONSHIP TO RaTG13 PROVIDES EVIDENCE THAT 2019-nCoV MAY HAVE ORIGINATED IN BATS." "WE RAPIDLY DEVELOPED A QPCR-BASED DETECTION METHOD on the basis of the sequence of the receptor-binding domain of the S gene, which was the most variable region of the genome (Fig. 1c). Our data show that the primers could differentiate 2019-nCoV from all other human coronaviruses including bat SARSr-CoV WIV1, which shares 95% identity with SARS-CoV (Extended Data Fig. 4a, b). Of the samples obtained from the seven patients, WE FOUND THAT SIX BALF AND FIVE ORAL SWAB SAMPLES WERE POSITIVE FOR 2019-nCoV during the first sampling, as assessed by qPCR and conventional PCR." "WE NEXT SUCCESSFULLY ISOLATED THE VIRUS (called 2019-nCoV BetaCoV/Wuhan/WIV04/2019) FROM BOTH VERO E6 AND Huh7 CELLS USING THE BALF SAMPLE OF PATIENT ICU-06. Clear cytopathogenic effects were observed in cells after incubation for three days (Extended Data Fig. 6a, b). The identity of the strain WIV04 was verified in Vero E6 cells by immunofluorescence microscopy using the cross-reactive viral N antibody (Extended Data Fig. 6c, d) and by metagenomics sequencing, most of the reads of which mapped to 2019-nCoV, and qPCR analysis showed that the viral load increased from day 1 to day 3 (Extended Data Fig. 6e, f). VIRAL PARTICLES IN ULTRATHIN SECTIONS OF INFECTED CELLS DISPLAYED A TYPICAL CORONAVIRUS MORPHOLOGY, as visualized by electron microscopy (Extended Data Fig. 6g)." "The study provides a detailed report on 2019-nCoV, THE LIKELY AETIOLOGICAL AGENT RESPONSIBLE FOR THE ONGOING EPIDEMIC OF ACUTE RESPIRATORY SYNDROME in China and other countries. Virus-specific nucleotide-positive and viral-protein seroconversion was observed in all patients tested and provides evidence of an association between the disease and the presence of this virus. However, there are still many urgent questions that remain to be answered. THE ASSOCIATION BETWEEN 2019-nCoV AND THE DISEASE HAS NOT BEEN VERIFIED BY ANIMAL EXPERIMENTS TO FULFIL THE KOCH'S POSTULATES TO ESTABLISH A CAUSATIVE RELATIONSHIP BETWEEN A MICROORGANISM AND A DISEASE. WE DO NOT YET KNOW THE TRANSMISSION ROUTINE OF THIS VIRUS AMONG HOSTS." "Sample collection Human samples, including oral swabs, anal swabs, blood and BALF samples were collected by Jinyintan hospital (Wuhan, China) with the consent of all patients and approved by the ethics committee of the designated hospital for emerging infectious diseases. Patients were sampled without gender or age preference unless indicated. FOR SWABS, 1.5 ml DMEM CONTAINING 2% FBS WAS ADDED TO EACH TUBE. The supernatant was collected after centrifugation at 2,500 rpm, vortexing for 60 s and a standing period of 15–30 min. The supernatant from swabs or BALF (no pre-treatment) was added to either lysis buffer for RNA extraction OR TO VIRAL TRANSPORT MEDIUM FOR ISOLATION OF THE VIRUS. THE VIRAL TRANSPORT MEDIUM WAS COMPOSED OF HANK'S BALANCED SALT SOLUTION (pH 7.4) CONTAINING BSA (1%), AMPHOTERICIN (15 μg ml−1), PENICILLIN G (100 units ml−1) AND streptomycin (50 μg ml−1). Serum was separated by centrifugation at 3,000g for 15 min within 24 h of collection, followed by inactivation at 56 °C for 1 h, and was then stored at 4 °C until use. Virus isolation, cell infection, electron microscopy and neutralization assay The following cell lines were used for virus isolation in this study: VERO E6 AND Huh7 CELLS, WHICH WERE CULTURED IN DMEM CONTAINING 10% FBS. All cell lines were tested and free of mycoplasma contamination, submitted for species identification and authenticated by morphological evaluation by microscopy. None of the cell lines was on the list of commonly misidentified cell lines (by ICLAC). CULTURED CELL MONOLAYERS WERE MAINTAINED IN THEIR RESPECTIVE MEDIUM. The PCR-positive BALF sample from ICU-06 patient was spun at 8,000g for 15 min, filtered and DILUTED 1:2 WITH DMEM SUPPLEMENTED WITH 16 μg ml−1 TRYPSIN BEFORE IT WAS ADDED TO THE CELLS. After incubation at 37 °C for 1 h, THE INOCULUM WAS REMOVED AND REPLACED WITH FRESH CULTURE MEDIUM CONTAINING ANTIBIOTICS (see below) and 16 μg ml−1 trypsin. The cells were incubated at 37 °C and observed daily for cytopathogenic effects. The culture supernatant was examined for the presence of virus by qRT–PCR methods developed in this study, and cells were examined by immunofluorescence microscopy using the anti-SARSr-CoV Rp3 N antibody that was generated in-house (1:1,000). PENICILLIN (100 units ml−1) AND STREPTOMYCIN (15 μg ml−1) WERE INCLUDED IN ALL TISSUE CULTURE MEDIA. VERO E6 CELLS WERE INFECTED WITH THE NEW VIRUS at a multiplicity of infection (MOI) of 0.5 and collected 48 h after infection. CELLS WERE FIXED WITH 2.5% (w/v) GLUTARALDEHYDE AND 1% OSMIUM TETROXIDE, DEHYDRATED THROUGH A GRADED SERIES OF ETHANOL CONCENTRATIONS (from 30 to 100%) AND EMBEDDED WITH EPOXY RESIN. Ultrathin sections (80 nm) of embedded cells were prepared, deposited onto Formvar-coated copper grids (200 mesh), stained with uranyl acetate and lead citrate, and analysed using a 200-kV Tecnai G2 electron microscope." "SAMPLES FROM PATIENT BALF OR FROM THE SUPERNATANT OF VIRUS CULTURES WERE USED FOR RNA EXTRACTION AND NEXT-GENERATION SEQUENCING (NGS) using BGI MGISEQ2000 and Illumina MiSeq 3000 sequencers." https://www.nature.com/articles/s41586-020-2012-7#ref-CR13 In Summary: -the discovery of this new "Coronavirus" started from the sequencing of a genome from the unpurified BALF of sick patients -the sequences were only 79.8% similar to the original SARS -they were, however, 96.2% similar to a bat "Coronavirus" named RaTG13 -the cases of disease were determined to be caused by a "virus" based on clinical symptoms and other measures as well as the lack of improvement after 3 days of antibiotic use -they tested samples from seven patients with "Coronavirus" PCR primers based on the hunch that it may be SARS due to the location of the patients -5 of the 7 tested positive by PCR for "Coronaviruses" and the BALF from one patient was sent for metagenomic sequencing as detailed here: https://m.facebook.com/story.php?story_fbid=10158002029508576&id=502548575 https://m.facebook.com/story.php?story_fbid=10158048691828576&id=502548575 -they next quickly developed their own PCR test to detect "SARS-COV-2" in the BALF of 6 out of 7 patients and from the oral swabs of 5 out of 7 patients -they finally decided to "isolate" the "virus" in Vero and HuH7 cell cultures AFTER they had determined their genome and made their PCR test -they looked at unpurified cell culture supernatant in an Electron Microscope and saw "Coronavirus-like" particles (from which there are many similar looking particles within the sample) and decided that was their "virus" -they concluded in their study that "SARS-COV-2" is the LIKELY aetiological agent causing disease -they then admit that they did not fulfill Koch's Postulates to actually determine whether or not their new "virus" actually causes disease -they admit animal studies to reproduce the same disease as seen in humans were still needed -they admit the mode of transmission for the "virus" was unknown As with MERS before it, this whole study and the hysteria surrounding "SARS-COV-2" can be completely thrown out due to the researchers admitting that they never fulfilled Koch's Postulates nor proved that their letters in a database actually exists nor causes disease. They mention EM images yet never supplied any in the study. They never mention any attempts at purification. They started with a genome before they ever attempted "isolating" a "virus." The genomes used as references to create "SARS-COV-2" came from unpurified and highly questionable sources. This paper is one big fraudulent mess. If you can not see the lies of Virology by reading these papers, you aren't trying very hard as they are there, clear as day for all to see. PARK 2020 "SARS-COV-2" PAPER: “WE DID NOT OBTAIN AN ELECTRON MICROGRAPH SHOWING THE DEGREE OF PURIFICATION.” Replying Author: Wan Beom Park https://off-guardian.org/2020/06/27/covid19-pcr-tests-are-scientifically-meaningless This paper is often cited by many as proof that "SARS-COV-2" exists and has been "isolated" from a sick patient. The problem is, they only read the title of the study. Had they read the study itself, it would be obvious to them that what the researchers call "isolation" of a "virus" is the exact opposite as they used the same cell culture soup full of foreign animal DNA, antibiotics/antifungals, "nutrients," chemicals, etc. that is used in the previous "Coronavirus" papers. Adding various ingredients together with the sample taken from a sick patient and incubating it for days until nonspecific cell damage called Cytopathic Effects (CPE) is observed is not isolation. It is nothing more than unpurified witches brew, as can be seen from the quote above by lead researcher Wan Beom Park admitting they did not purify anything. Highlights from his study below: VIRUS ISOLATION FROM THE FIRST PATIENT WITH SARS-CoV-2 IN KOREA "Here, we report the isolation of SARS-CoV-2 USING VERO CELLS from a patient entering Korea from Wuhan, China. The patient with the FIRST LABORATORY-CONFIRMED SARS-CoV-2 INFECTION in Korea is published previously.6 Briefly, a 35-year-old woman developed fever, chill, and myalgia on January 18, 2020, and arrived at the Incheon airport from Wuhan on the next day. AFTER LABORATORY-CONFIRMED DIAGNOSIS OF SARS-CoV-2 INFECTION, she developed nasal congestion, cough, and sputum. Oxygen supplementation was started on day 4 of her illness, and her oxygen requirement increased to 6 L/min on day 7 of illness. Fever persisted for ten days and her maximum body temperature during her illness was 38.9°C on day 7 of illness. THE PATIENT'S OROPHARYNGEAL SAMPLES WERE OBTAINED BY USING UTM™ kit CONTAINING 1 mL OF VIRAL TRANSPORT MEDIA (Copan Diagnostics Inc., Murrieta, CA, USA) on day 7 of her illness. WE INOCULATED MONOLAYERS OF VERO CELLS (ATCC ® CCL-81™) with the samples and cultured the cells at 37°C in a 5% carbon dioxide atmosphere. Until 5 days after inoculation, cytopathic effects were not distinct, which is compatible with the previous findings that no specific cytopathic effects were observed in the Vero E6 cells until 6 days after inoculation in the report about first isolation of SARS-CoV-2.3 FIVE DAYS AFTER INOCULATION, WE DID BLIND PASSAGE OF CULTURE SUPERNATANT INTO T-25 CULTURE FLASK (ThermoFisher Scientific Inc., Waltham, MA, USA) WITH MONOLAYERS OF VERO CELLS, and cytopathic effects consisting of rounding and detachment of cells were observed in the whole area of the T-25 flask 3 DAYS AFTER THE FIRST BLIND PASSAGE (Fig. 1A and B). IN ORDER TO OBSERVE VIRUS PARTICLES, VERO CELL MONOLAYER SHOWING THE CYTOPATHIC EFFECTS WAS FIXED as previously described.7 It was cut on ultramicrotome (RMC MT-XL; RMC Boeckeler, Tucson, AZ, USA) at 65 nm. Ultrathin sections were stained with saturated 4% uranyl acetate and 1% lead citrate before examination with a transmission electron microscope (JEM-1400; JEOL USA Inc., Peabody, MA, USA) at 80 kV. Spherical particles with crown-like spikes ranging 66 to 81 nm in diameter were observed within the cytoplasmic vesicles and in the extracellular space adjacent to cell membrane (Fig. 1C and D). FOR WHOLE GENOME SEQUENCING OF THE VIRUS ISOLATE (BetaCoV/Korea/SNU01/2020), CULTURE SUPERNATANT OF VERO CELLS INFECTED WAS USED FOR RNA EXTRACTION. RNA was extracted by using QIAamp viral RNA mini kit (QIAGEN, Valencia, CA, USA), according to the manufacturer's instructions. RNA libraries were prepared using TruSeq Stranded Total RNA Kit (catalog No. 20020596; Illumina, San Diego, CA, USA) according to the manufacturer protocol. Sequencing was performed on an Illumina Nextseq 500 platform, produced on average a total of 150 million reads, 150 bp per sample, as per the manufacturer's instructions in Macrogen Inc. (Seoul, Korea).8,9,10 FASTQ was used to trim the adapter and remove low quality bases and reads. QUALIFIED READS WERE MAPPED TO NC_045512, A SARS-CoV-2 GENOME REFERENCE using Burrows-Wheeler Aligner (v0.7.12-r1039), and a bam file was produced.11 In this bam file, the variation was confirmed by comparing with genome using SAMtools (v1.3.1).12 For genome-base phylogeny analysis, 37 strains including BetaCoV/Korea/KCDC03/2020 were used in combination with BetaCoV/Korea/SNU01/2020. The sequences used for analysis were downloaded from NCBI (http://www.ncbi.nlm.nih.gov/) and GISAID (http://www.gisaid.org). The 37 strain genomes were multiple-sequence aligned using MAFFT (v7.450), a sequence alignment tool, and were used to generate phylogenetic tree.13 Phylogenetic analysis of the aligned sequence was performed with 1,000 bootstrap replicates using MEGAX and a general time-reversible model used as the nucleotide substitution model.14 NEXT-GENERATION SEQUENCING OF BetaCoV/Korea/SNU01/2020 (GenBank accession no. MT039890) REVEALED 9 MUTATIONS COMPARED TO THE NC_045512 REFERENCE GENOME ISOLATED FROM WUHAN (Table 1). Most of the mutations in our isolate consisted of 70% alternative genes and 30% reference genes (NC_045512). Five variants were found in ORF1ab, one variant in S gene, two variants in ORF3a, and one variant in E gene. Of the nine mutations, six also showed changes in amino acids. When comparing our isolate with the one isolated from the Korea Centers for Disease Control and Prevention (BetaCoV/Korea/KCDC03/2020), 12 VARIANTS INCLUDING THE ABOVE 9 MUTATIONS WERE FOUND. THESE MUTATIONS MAY OCCUR BY CELL CULTURE-ADAPTATION IN THAT OUR CULTURE ISOLATE WAS OBTAINED AFTER FIRST BLIND PASSAGE, or by micro-evolution of SARS-CoV-2 before acquisition in Wuhan. BECAUSE THOSE GENOME SEQUENCES ARE QUITE HOMOLOGOUS EACH OTHER, IT IS DIFFICULT TO VALIDATE THESE TWO HYPOTHESIS.`` "In summary, we ISOLATED SARS-CoV-2 USING VERO CELLS FROM THE FIRST LABORATORY-CONFIRMED SARS-COV-2-INFECTED PATIENT in Korea. Phylogenetic analyses of the whole genome sequences showed that it clustered with other SARS-CoV-2 reported from Wuhan, China." https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7036342/ -In Summary: -they "isolated" their "virus" using Vero cell (African Green Monkey kidneys) culture -the case is considered the first laboratory-confirmed case in Korea -they took an oropharyngeal (throat) sample and immediately placed it in Viral Transport Media (ingredients not listed) -this sample was inoculated directly onto the Vero cells -they did not observe any CPE after 5 days so they did a first blind passage into a new flask of Vero cells and 3 days later observed CPE -the process of blind passaging cells can damage/alter the sample as detailed here: https://m.facebook.com/story.php?story_fbid=10158084526738576&id=502548575 -in order to observe "virus," the Vero cells showing CPE (to which they admitted was not purified) were fixed for EM imaging in order to find the spherical crown-like particles they wanted to see -for whole-genome sequencing, RNA was extracted from the same unpurified Vero cell sample -"qualified" reads were then mapped to an already prepared "SARS-COV-2" reference genome -there were 9 "mutations" found in the Korea "virus" that differed from the Wuhan reference "virus" -when comparing to a genome from the Korean CDC, they found that their genome had 12 "mutations" including the 9 from the Wuhan reference -they admit that the culturing process may have created these "mutations" through cell-culture adaptation as they obtained their genome after the first blind passage The problem for papers like this, beyond the fact that they have completely inverted the meaning of the word ISOLATION, is that they do not perform the necessary controls to find out if the CPE they observe in the cell culture soup is created by a "virus" or from the cell-culturing process itself. The researchers here at least admit they are unable to determine if the "mutations" in their genome were created by the culturing process. If they took it a step further, they would realize that they can never prove that what they created through their chemistry experiments in a lab was ever in the original sample to begin with. This is why it is absolutely necessary to purify/isolate the particles believed to be "virus" DIRECTLY from the UNALTERED patient sample and not from experimental soup in a lab. ZHU 2020 "SARS-COV-2" PAPER: "[We show] an image of sedimented virus particles, NOT PURIFIED ONES.” -Replying Author: Wenjie Tan https://off-guardian.org/2020/06/27/covid19-pcr-tests-are-scientifically-meaningless/ The Zhu study gets the infamous distinction of not only admitting to not purifying their "isolates" but also to not fulfilling Koch's Postulates. They present similar evidence and findings as the earlier Zhou study yet neither of them were able to satisfy the proper scientific criteria needed to prove a new "virus" exists nor that it can also cause disease. Highlights below: A NOVEL CORONAVIRUS FROM PATIENTS WITH PNEUMONIA IN CHINA, 2019 "VIRAL DIAGNOSTIC METHODS FOUR LOWER RESPIRATORY TRACT SAMPLES, INCLUDING BRONCHOALVEOLAR-LAVAGE FLUID, WERE COLLECTED FROM PATIENTS WITH PNEUMONIA OF UNKNOWN CAUSE who were identified in Wuhan on December 21, 2019, or later and who had been present at the Huanan Seafood Market close to the time of their clinical presentation. SEVEN BRONCHOALVEOLAR-LAVAGE FLUID SPECIMENS WERE COLLECTED FROM PATIENTS IN BEIJING HOSPITALS WITH PNEUMONIA OF KNOWN CAUSE TO SERVE AS CONTROL SAMPLES." ISOLATION OF VIRUS "Bronchoalveolar-lavage fluid samples were collected in sterile cups TO WHICH VIRUS TRANSPORT MEDIUM WAS ADDED. Samples were then centrifuged to remove cellular debris. The supernatant was inoculated on human airway epithelial cells,13 WHICH HAD BEEN OBTAINED FROM AIRWAY SPECIMENS RESECTED FROM PATIENTS UNDERGOING SURGERY FOR LUNG CANCER and were confirmed to be special-pathogen-free by NGS.14" "Prior to infection, apical surfaces of the HUMAN AIRWAY EPITHELIAL CELLS WERE WASHED THREE TIMES WITH PHOSPHATE-BUFFERED SALINE; 150 μl OF SUPERNATANT FROM BRONCHOALVEOLAR-LAVAGE FLUID SAMPLES WAS INOCULATED ONTO THE APICAL SURFACE OF THE CELL CULTURES. After a 2-hour incubation at 37°C, UNBOUND VIRUS WAS REMOVED BY WASHING WITH 500 μl OF PHOSPHATE-BUFFERED SALINE FOR 10 MINUTES; human airway epithelial cells were maintained in an air–liquid interface incubated at 37°C with 5% carbon dioxide. EVERY 48 HOURS, 150 μl OF PHOSPHATE-BUFFERED SALINE WAS APPLIED TO THE APICAL SURFACES OF THE HUMAN AIRWAY EPITHELIAL CELLS, and after 10 minutes of incubation at 37°C the samples were harvested. Pseudostratified mucociliary epithelium cells were maintained in this environment; apical samples were passed in a 1:3 diluted vial stock to new cells. The cells were monitored daily with light microscopy, for cytopathic effects, and with RT-PCR, for the presence of viral nucleic acid in the supernatant. AFTER THREE PASSAGES, APICAL SAMPLES AND HUMAN AIRWAY EPITHELIAL CELLS WERE PREPARED FOR TRANSMISSION ELECTRON MICROSCOPY. TRANSMISSION ELECTRON MICROSCOPY Supernatant from human airway epithelial cell cultures that showed cytopathic effects was collected, INACTIVATED WITH 2% PARAFORMALDEHYDE FOR AT LEAST 2 HOURS, and ultracentrifuged to sediment virus particles. The enriched supernatant was negatively stained on film-coated grids for examination. Human airway epithelial cells showing cytopathic effects were collected AND FIXED WITH 2% PARAFORMALDEHYDE–2.5% GLUTARALDEHYDE AND WERE THEN FIXED WITH 1% OSMIUM TETROXIDE DEHYDRATED WITH GRADE ETHANOL EMBEDDED WITH PON812 RESIN. Sections (80 nm) were cut from resin block and stained with uranyl acetate and lead citrate, separately. The negative stained grids and ultrathin sections were observed under transmission electron microscopy." "VIRAL GENOME SEQUENCING RNA EXTRACTED FROM BRONCHOALVEOLAR-LAVAGE FLUID AND CULTURE SUPERNATANTS WAS USED AS A TEMPLATE TO CLONE AND SEQUENCE THE GENOME." "DETECTION AND ISOLATION OF A NOVEL CORONAVIRUS Three bronchoalveolar-lavage samples were collected from Wuhan Jinyintan Hospital on December 30, 2019. No specific pathogens (including HCoV-229E, HCoV-NL63, HCoV-OC43, and HCoV-HKU1) were detected in clinical specimens from these patients by the RespiFinderSmart22kit. RNA extracted from bronchoalveolar-lavage fluid from the patients was used as a template to clone and sequence a genome using a combination of Illumina sequencing and nanopore sequencing. More than 20,000 viral reads from individual specimens were obtained, and most contigs matched to the genome from lineage B of the genus betacoronavirus — SHOWING MORE THAN 85% IDENTITY WITH A BAT SARS-like CoV (bat-SL-CoVZC45, MG772933.1) GENOME PUBLISHED PREVIOUSLY. Positive results were also obtained with use of a real-time RT-PCR assay for RNA targeting to a consensus RdRp region of pan β-CoV (ALTHOUGH THE CYCLE THRESHOLD VALUE WAS HIGHER THAN 34 for detected samples). VIRUS ISOLATION FROM THE CLINICAL SPECIMENS WAS PERFORMED WITH HUMAN AIRWAY EPITHELIAL CELLS AND VERO E6 AND Huh-7 CELL LINES. The isolated virus was named 2019-nCoV." "Electron micrographs of negative-stained 2019-nCoV particles were generally spherical WITH SOME PLEOMORPHISM (Figure 3). Diameter varied from about 60 to 140 nm. Virus particles had quite distinctive spikes, about 9 to 12 nm, and gave virions the appearance of a solar corona. Extracellular free virus particles and inclusion bodies filled with virus particles in membrane-bound vesicles in cytoplasm were found in the human airway epithelial ultrathin sections. THIS OBSERVED MORPHOLOGY IS CONSISTENT WITH THE CORONAVIRIDAE FAMILY." "Discussion We report a novel CoV (2019-nCoV) that was identified in hospitalized patients in Wuhan, China, in December 2019 and January 2020. Evidence for the presence of this virus includes IDENTIFICATION IN BRONCHOALVEOLAR-LAVAGE FLUID IN THREE PATIENTS BY WHOLE-GENOME SEQUENCING, DIRECT PCR, AND CULTURE. THE ILLNESS LIKELY TO HAVE BEEN CAUSED BY THIS CoV was named “novel coronavirus-infected pneumonia” (NCIP)." "Molecular techniques have been used successfully to identify infectious agents for many years. Unbiased, high-throughput sequencing is a powerful tool for the discovery of pathogens.14,16 Next-generation sequencing and bioinformatics are changing the way we can respond to infectious disease outbreaks, improving our understanding of disease occurrence and transmission, accelerating the identification of pathogens, and promoting data sharing. WE DESCRIBE IN THIS REPORT THE USE OF MOLECULAR TECHNIQUES AND UNBIASED DNA SEQUENCING TO DISCOVER A NOVEL BETACORONAVIRUS THAT IS LIKELY TO HAVE BEEN THE CAUSE OF SEVERE PNEUMONIA IN THREE PATIENTS IN WUHAN, CHINA. Although establishing human airway epithelial cell cultures is labor intensive, they appear to be a valuable research tool for analysis of human respiratory pathogens.13 Our study showed that INITIAL PROPAGATION OF HUMAN RESPIRATORY SECRETIONS ONTO HUMAN AIRWAY EPITHELIAL CELL CULTURES, FOLLOWED BY TRANSMISSION ELECTRON MICROSCOPY AND WHOLE GENOME SEQUENCING OF CULTURE SUPERNATANT, was successfully used for visualization and detection of new human coronavirus THAT CAN POSSIBLY ELUDE IDENTIFICATION BY TRADITIONAL APPROACHES." "ALTHOUGH OUR STUDY DOES NOT FULFILL KOCH’S POSTULATES, OUR ANALYSES PROVIDE EVIDENCE IMPLICATING 2019-nCoV IN THE WUHAN OUTBREAK. ADDITIONAL EVIDENCE TO CONFIRM THE ETIOLOGIC SIGNIFICANCE OF 2019-nCoV in the Wuhan outbreak include IDENTIFICATION OF A 2019-nCoV ANTIGEN in the lung tissue of patients by immunohistochemical analysis, DETECTION OF IgM AND IgG ANTIVIRAL ANTIBODIES IN THE SERUM SAMPLES FROM A PATIENT AT TWO TIME POINTS TO DEMONSTRATE SEROCONVERSION, AND ANIMAL (monkey) EXPERIMENTS TO PROVIDE EVIDENCE OF PATHOGENICITY. Of critical importance are epidemiologic investigations to CHARACTERIZE TRANSMISSION MODES, REPRODUCTION INTERVALS, AND CLINICAL SPECTRUM resulting from infection to inform and refine strategies that can prevent, control, and stop the spread of 2019-nCoV." https://www.nejm.org/doi/full/10.1056/nejmoa2001017 In Summary: -they collected samples, including BALF fluid, from 4 patients with pneumonia for whom they could not determine a cause -they used samples from 7 patients with pneumonia of known causes as "controls" -the BALF from the 7 patients was added to Viral Transport Medium -they used human airway epithelial cells from lung cancer patients to culture their "virus" which were regularly washed with and stored in phosphate-buffered saline which can be toxic to cells: https://m.facebook.com/story.php?story_fbid=10158076065703576&id=502548575 -the unpurified cell culture supernatant was used for the EM images in the study -on top of the numerous toxic chemicals used during the culturing/washing process, paraformaldehyde was added to the supernatant for 2 hours to prepare it for TEM imaging -more paraformaldehyde as well as glutaraldehyde were added and then the sample was fixed with osmium tetroxide dehydrated with grade ethanol and embedded in resin -sections were cut from the resin and stained with uranyl acetate and lead citrate -these processes not only kill and alter the cells, they can create artifacts in the TEM images as well: https://m.facebook.com/story.php?story_fbid=10158103093818576&id=502548575 https://m.facebook.com/story.php?story_fbid=10158104257928576&id=502548575 -RNA extracted from the unpurified BALF and culture supernatant were used as a template to clone and generate the genome -their genome shared more than 85% identity match to the bat "Coronavirus" RaTG13 -PCR Ct Values were higher than 34 for the detected samples (which, according to Fauci, would be nothing but dead nucleotides) -"virus" isolation was carried out in human airway epithelial cells, Vero cells, and HuH7 cells -they observed "Coronavirus-like' particles with some pleomorphism (variability of size, shape, and staining of cells) in their unpurified cell culture sample -their evidence consists of whole-genome sequencing from unpurified BALF of 3 patients, direct PCR, and cell culture -the illness LIKELY TO HAVE BEEN CAUSED by their new "virus" was named 2019-nCoV -they talk up their indirect molecular techniques as being suitable to identify a novel "virus" which is LIKELY TO BE THE CAUSE of an unknown pneumonia -they state they were able to capture and identify this unknown "virus" through TEM images, cell cultures, and WGS sequencing from unpurified cell culture supernatant as it may have eluded identification by TRADITIONAL approaches -they then admit that they did not satisfy Koch's Postulates, the very criteria needed to be met in order to prove a new pathogenic "virus" exists -more evidence is needed to confirm its etiological significance such as: identifying an antigen, detection of IgG and IgM antibodies at two time intervals to show seroconversion, and animal experiments to prove pathogenicity -further studies are also needed to characterize transmission modes, reproduction intervals, and determine clinical spectrum Once you break down the "evidence" (or lack thereof), it is clear to see that the world was locked down, quarantined, masked, social distanced, and vaccinated based on nothing at all. Neither the Zhu nor the Zhou studies fulfilled Koch's postulates. Both left it up to future studies from different teams of researchers using different patients with different samples and different methods to prove their hypotheses for them. At the very least, Zhu provided a pretty TEM image of some particles he picked to REPRESENT his "virus" from potentially billions of similar particles in the unpurified cell culture supernatant. But TEM images of particles that may or may not belong to the A's, C's, G's, and T's in a computer database that may or may not represent something in reality is not evidence of a new "virus." It is absolute fraud to present it as such. For more on TEM images and why purification/isolation of the particles is absolutely essential, read these related posts: https://www.facebook.com/502548575/posts/10158107068098576/ https://m.facebook.com/story.php?story_fbid=10158104434978576&id=502548575 Coronavirus discovery papers: D.A TYRRELL 1965 "CORONAVIRUS" DISCOVERY: https://docs.google.com/document/d/e/2PACX-1vTCTJaZOpHk-OtFNIspUMha6AsXQVVSoEggOkpoCcFOmhyetd9JNUay4L_OWQR6QyeP7vGhE1L-Q7SN/pub CDC 2020 "SARS-COV-2" PAPER: On March 7, 2020, the CDC released their study on the "isolation" and characterization of "SARS-COV-2" from the first US patient identified by PCR testing on January 22nd, 2020. As with every single paper before it, the CDC relies on unpurified cell cultures to claim "isolation" of a new "Coronavirus." They utilize the same unproven molecular tricks to create a genetic blueprint in a computer database for something they have never seen in reality. There are some interesting wrinkles I will point out with this particular study that put it squarely into unreliable territory along with all the others as well. Highlights below: ISOLATION AND CHARACTERIZATION OF SARS-CoV-2 FROM THE FIRST US COVID-19 PATIENT "RESULTS and DISCUSSION A patient was identified with confirmed COVID-19 in Washington State on January 22, 2020 with cycle threshold (Cts) of 18–20 (nasopharyngeal(NP)) and 21–22 (oropharyngeal (OP)) (1). THE POSITIVE CLINICAL SPECIMENS WERE ALIQUOTED AND REFROZEN INOCULATION INTO CELL CULTURE on January 22, 2020. We first observed cytopathic effect (CPE) 2 days post inoculation and harvested viral lysate on day 3 post inoculation (Figure 1B and ​and1C).1C). Fifty μl of P1 VIRAL LYSATES WERE USED FOR NUCLEIC ACID EXTRACTION TO CONFIRM THE PRESENCE OF SARS-CoV-2 USING THE CDC MOLECULAR DIAGNOSTIC ASSAY (1). The Cts of three different nucleic acid extractions ranged from 16.0–17.1 for N1, 15.9–17.1 for N2 and 16.2–17.3 for N3, confirming isolation of SARS-CoV-2. A Ct of less than 40 is considered positive. The extracts were also tested for the presence of 33 additional different respiratory pathogens with the fast track 33 assay. No other pathogens were detected. Identity was additionally supported by thin section electron microscopy (Figure 1D). WE OBSERVED A MORPHOLOGY AND MORPHOGENESIS CHARACTERISTIC OF CORONAVIRUSES. ISOLATES FROM THE FIRST PASSAGE OF AN OP AND AN NP SPECIMEN WERE USED FOR WHOLE GENOME SEQUENCING. The genomes from the NP specimen (Genbank accession MT020880) and OP specimen (Genbank accession MT020881) matched each other 100%. The isolates also matched the corresponding clinical specimen 100% (Genbank accession MN985325). AFTER THE SECOND PASSAGE, OP AND NP SPECIMENS WERE NOT CULTURED SEPARATELY. VIRUS ISOLATE WAS PASSAGED TWO MORE TIMES IN Vero CCL-81 CELLS, and titrated by TCID50. The titers of the third and fourth passages were 8.65 × 106 and 7.65 × 106 TCID50 per mL, respectively." "WE SUBSEQUENTLY GENERATED A FOURTH PASSAGE STOCK OF SARS-CoV-2 ON VeroE6 CELLS, ANOTHER FETAL RHESUS MONKEY KIDNEY CELL LINE. Viral RNA from SARS-CoV-2 passage four stock was sequenced and confirmed to have no nucleotide mutations compared with the original reference sequence (Genbank accession MN985325). Both SARS-CoV and MERS-CoV had been found to grow well on VeroE6 and Vero CCL81 respectively (12, 13). To establish a plaque assay and determine the preferred Vero cell type for quantification, we titered our passage four stock on VeroE6 and VeroCCL81. Following infection with a dilution series, we found that SARS-CoV-2 replicated in both Vero cell types; however, the viral titers were slightly higher in VeroE6 cells than Vero CCL81 (Figure 2A). In addition, plaques were more distinct and visible on Vero E6 (Figure 2B). As early as 2 days post inoculations, VeroE6 cells produced distinct plaques visible with neutral red staining. In contrast, Vero CCL81 produced less clear plaques and was most easily quantitated with neutral red 3 days post inoculation. On the individual plaque monolayers, SARS-CoV-2 infection of Vero E6 cells produced a cytopathic effect with areas of cell clearance (Figure 2C). In contrast, Vero CCL81 had areas of dead cells that had fused to form plaques, but the cells did not clear. Together, THE RESULTS SUGGEST THAT VeroE6 MAY BE THE BEST CHOICE FOR AMPLIFICATION AND QUANTIFICATION, but both Vero cell types support amplification and replication of SARS-CoV-2." "As research is initiated to study and respond to SARS-CoV-2, information about cell lines and types susceptible to infection is needed. THEREFORE, WE EXAMINED THE CAPACITY OF SARS-CoV-2 TO INFECT AND REPLICATE IN SEVERAL COMMON PRIMATE AND HUMAN CELL LINES, including human adenocarcinoma cells (A549), human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81. We also examined an available big brown bat kidney cell line (EFK3B) for SARS-CoV-2 replication capacity. Each cell line was inoculated with at high MOI and examined 24 hours post infection (Figure 3A). NO CYTOPATHIC EFFECT WAS OBSERVED IN ANY OF THE CELL LINES EXCEPT IN VERO CELLS which grew to >107 PFU at 24 hours post infection. In contrast, both HUH7.0 and 293T cells showed only modest viral replication and A549 cells were incompatible with SARS-CoV-2 infection. These results are consistent with previous susceptibility findings for SARS-CoV and suggest OTHER COMMON CULTURE SYSTEMS INCLUDING MDCK, HeLa, HEP-2, MRC-5 cells, and embryonated eggs ARE UNLIKELY TO SUPPORT SARS-CoV-2 REPLICATION (14–16). In addition, SARS-CoV-2 FAILED TO REPLICATE IN THE BAT EFK3B CELLS which are susceptible to MERS-CoV. Together, the results indicate that SARS-CoV-2 maintain a similar profile to SARS-CoV in terms of susceptible cell lines." "THE SARS-CoV-2 FOURTH PASSAGE VIRUS HAS BEEN SEQUENCED and maintains a nucleotide sequence identical to that of the original US clinical strain. These deposits make it available to the domestic and international public health, academic, and pharmaceutical sectors for basic research, diagnostic development, antiviral testing, and vaccine development." "Specimen collection Virus isolation from patient samples was deemed to be non-human subjects research by CDC National Center for Immunizations and Respiratory Diseases (research determination 0900f3eb81ab4b6e) Clinical specimens from the first identified US case of COVID-19 acquired during travel to china, were collected as described (1). NASOPHARYNGEAL (NP) AND OROPHARYNGEAL (OP) SWABS in 2 to 3 mL VIRAL TRANSPORT MEDIA were collected on day 3 post-symptom onset for molecular diagnosis and frozen. Confirmed PCR- positive specimens were aliquoted and refrozen until virus isolation was initiated. Cell culture, limiting dilution, and isolation VERO CCL-81 CELLS WERE USED FOR ISOLATION AND INITIAL PASSAGE. Vero E6, Vero CCL-81, HUH 7.0, 293T, A549, and EFKB3 cells WERE CULTURED IN DULBECCO’S MINIMAL ESSENTIAL MEDIUM (DMEM) SUPPLEMENTED WITH HEAT INACTIVATED FETAL BOVINE SERUM (5 or 10%) AND ANTIBIOTIC/ANTIMYOTIC (GIBCO). Both NP and OP swabs were used for virus isolation. For the isolation, limiting dilution, and passage 1 of the virus, 50 μl serum free DMEM was pipetted into columns 2–12 of a 96-well tissue culture plate. One-hundred μl clinical specimens were pipetted into column 1, and then serially diluted 2-fold across the plate. VERO CELLS WERE TRYPSINIZED AND RESUSPENDED IN DMEM + 10% FBS + 2X PENICILLIN-STREPTOMYCIN + 2X ANTIBIOTIC − ANTIMYCOTIC + 2 X AMPHOTERICIN B at 2.5 × 105 cells / ml. ONE HUNDRED μl OF CELL SUSPENSION WERE ADDED DIRECTLY TO THE CLINICAL SPECIMEN DILUTIONS AND MIXED GENTLY BY PIPETTING. The inoculated cultures were grown in a humidified 37°C incubator with 5% CO2 and observed for cytopathic effect (CPE) daily. Standard plaque assays were used for SARS-CoV-2 based on both SARS-CoV and MERS-CoV protocols (19, 20). When CPE was observed, the cell monolayers were scrapped with the back of a pipette tip. FIFTY μl OF THE VIRAL LYSATE WERE USED FOR TOTAL NUCLEIC ACID EXTRACTION FOR CONFIRMATORY TESTING AND SEQUENCING. Fifty μl of virus lysate was used to inoculate a well of a 90% confluent 24-well plate." "Inclusivity / Exclusivity testing From the wells in which CPE were observed, CONFIRMATORY TESTING WAS PERFORMED USING CDC’s rRT-PCR ASSAY and full genome sequencing (1) The CDC molecular diagnostic assay targets three portions of the N gene, and all three must be positive to be considered positive (https://www.cdc.gov/.../rt-pcr-detection-instructions.html) and (https://www.cdc.gov/.../lab/rt-pcr-panel-primer-probes.html). To confirm that no other respiratory viruses were present, Fast Track respiratory pathogen 33 testing was performed (FTD diagnostics)." "Whole genome sequencing. THIRTY-SEVEN PAIRS OF NESTED PCR ASSAYS SPANNING THE GENOME WERE DESIGNED BASED ON THE REFERENCE SEQUENCE, Genbank Accession No. NC045512. NUCLEIC ACID WAS EXTRACTED FROM ISOLATES AND AMPLIFIED BY THE 37 INDIVIDUAL NESTED PCR ASSAYS. Positive PCR amplicons were used individually for subsequent Sanger sequencing and also pooled for library preparation using a ligation sequencing kit (Oxford Nanopore Technologies), subsequently for Oxford Nanopore MinION sequencing. CONSENSUS NANOPORE SEQUENCES were generated using minimap 2.17 and samtools 1.9. CONSENSUS SEQUENCES BY SANGER SEQUENCES were generated from both directions using Sequencher 5.4.6, and WERE FURTHER CONFIRMED BY CONSENSUS SEQUENCES GENERATED FROM NANOPORE SEQUENCING." https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7239045 In Summary: -on January 22nd, 2020, a patient was confirmed positive by the CDC PCR test - nasopharyngeal (NP) and oropharyngeal (OP) samples were inoculated onto cell cultures and frozen -viral lysates from cell culture were used for nucleic acid extraction using the CDC PCR test to confirm "SARS-COV-2" Quick sidenote: the CDC's PCR test was initially recalled due to producing too many false-positives. The new version also produced many false-positives and in one study both the negative controls and water tested positive for "SARS-COV-2:" Obviously, any data coming from their PCR tests should be discounted: https://m.facebook.com/story.php?story_fbid=10157490601713576&id=502548575 https://m.facebook.com/story.php?story_fbid=10157886243208576&id=502548575 https://m.facebook.com/story.php?story_fbid=10157862596748576&id=502548575 -they observed "Coronavirus-like" morphology/morphogenesis in their unpurified EM images -unpurified "isolates" from the first passage cell culture of both NP and OP swabs were used for whole-genome sequencing -after second passage, both NP and OP samples were cultured together in Vero cells -they generated "viral" stocks from fourth passaged VeroE6 (fetal rhesus monkey kidney) cells -VeroE6 cells were determined to produce the "virus" the easiest -they decided to test whether "SARS-COV-2" would replicate in other primate and HUMAN cell lines -no cytopathic effect (CPE) occurred in any of the other cell lines used, only Vero cells -they determined that the "virus" COULD NOT infect/replicate in HUMAN nor many other common cell lines including MDCK, HeLa, HEP-2, MRC-5 cells, and embryonated eggs nor in Bat EFK3B cells -the NP and OP swabs were immediately placed in viral transport media -VeroE6 cells were added to DMEM media along with fetal bovine serum and several antibiotics/antimycotics -VeroE6 cells were trypsinized and suspended in added DMEM, FBS, 2x penicillin-streptomycin, 2x amphotericin B -the VeroE6 concoction was added to the NP/OP samples and mixed together -this unpurified creation was used for total nucleic acid extraction, confirmatory testing, and sequencing -for Whole-Genome Sequencing, ONLY 37 base pairs were used yet the "SARS-COV-2" genome consists of 30,000 base pairs: "THIRTY THOUSAND BASE PAIRS MAKE UP THE (relatively tiny) SARS-CoV-2 GENOME. A singular genome holds limited information." https://www.genengnews.com/news/mining-the-sars-cov-2-genome-for-answers/ Dr. Tom Cowan did a brilliant breakdown of why this is an issue: “… we find that rather than having isolated the virus and sequencing the genome from end to end, THEY FOUND 37 BASE PAIRS FROM UNPURIFIED SAMPLES USING PCR PROBES. This means they actually looked at 37 out of the approximately 30,000 of the base pairs that are claimed to be the genome of the intact virus. THEY THEN TOOK THESE 37 SEGMENTS AND PUT THEM INTO A COMPUTER PROGRAM, WHICH FILLED IN THE REST OF THE BASE PAIRS. “To me, this computer-generation step constitutes scientific fraud. Here is an equivalency: A group of researchers claim to have found a unicorn because they found a piece of a hoof, a hair from a tail, and a snippet of a horn. “They then add that information into a computer and program it to re-create the unicorn, and they then claim this computer re-creation is the real unicorn. Of course, they had never actually seen a unicorn so could not possibly have examined its genetic makeup to compare their samples with the actual unicorn’s hair, hooves and horn.” https://luis46pr.wordpress.com/2020/11/02/study-cdc-scientists-make-2-covid-admissions-that-destroy-official-narrative In this CDC study, we have unpurified cell cultures, faulty PCR tests/data, evidence "SARS-COV-2" can not infect human cells but only Vero cells, and a genome made up almost entirely by consensus computer-algorithms. In short, more "scientific" FRAUD. DROSTEN 2020 "SARS-COV-2" PCR PAPER: In Silico: in or on a computer : done or produced by using computer software or simulation I won't go into too much detail regarding the Drosten PCR test as it was covered beautifully by people much better suited than I (linked below), but I would be remiss if I did not mention it at all. Drosten was instrumental in the fraud that was "SARS-COV-1" and naturally, his experience in regards to manipulating the masses with pseudoscience was put to good use with "SARS-COV-2." He has so much experience with these "viruses," he was able to create a "diagnostic" PCR test in silico in the absence of any "SARS-COV-2 isolates" based primarily off of social media reports. That takes talent folks. Highlights below: DETECTION OF 2019 NOVEL CORONAVIRUS (2019-nCoV) BY REAL-TIME RT-PCR "Background The ongoing outbreak of the recently emerged novel coronavirus (2019-nCoV) poses a challenge for public health laboratories AS VIRUS ISOLATES ARE UNAVAILABLE while there is growing evidence that the outbreak is more widespread than initially thought, and international spread through travellers does already occur. AIM We aimed to develop and deploy robust diagnostic methodology for use in public health laboratory settings WITHOUT HAVING VIRUS MATERIAL AVAILABLE. METHODS Here we present a validated diagnostic workflow for 2019-nCoV, ITS DESIGN RELYING ON CLOSE GENETIC RELATEDNESS OF 2019-nCoV WITH SARS CORONAVIRUS, MAKING USE OF SYNTHETIC NUCLEIC ACID TECHNOLOGY. RESULTS The workflow reliably detects 2019-nCoV, and further discriminates 2019-nCoV from SARS-CoV. Through coordination between academic and public laboratories, we confirmed assay exclusivity BASED ON 297 ORIGINAL CLINICAL SPECIMENS CONTAINING A FULL SPECTRUM OF HUMAN RESPIRATORY VIRUSES. Control material is made available through European Virus Archive – Global (EVAg), a European Union infrastructure project." "A novel coronavirus currently termed 2019-nCoV was officially announced as the causative agent by Chinese authorities on 7 January. A viral genome sequence was released for immediate public health support via the community online resource virological.org on 10 January (Wuhan-Hu-1, GenBank accession number MN908947 [2]), followed by four other genomes deposited on 12 January in the viral sequence database curated by the Global Initiative on Sharing All Influenza Data (GISAID). THE GENOME SEQUENCES SUGGEST PRESENCE OF A VIRUS closely related to the members of a viral species termed severe acute respiratory syndrome (SARS)-related CoV, a species defined by the agent of the 2002/03 outbreak of SARS in humans [3,4]. The species also comprises a large number of viruses mostly detected in rhinolophid bats in Asia and Europe." "Among the foremost priorities to facilitate public health interventions is reliable laboratory diagnosis. In acute respiratory infection, RT-PCR is routinely used to detect causative viruses from respiratory secretions. We have previously demonstrated the feasibility of introducing robust detection technology based on real-time RT-PCR in public health laboratories during international health emergencies by coordination between public and academic laboratories [6-12]. IN ALL OF THESE SITUATIONS, VIRUS ISOLATES WERE AVAILABLE AS THE PRIMARY SUBSTRATE FOR ESTABLISHING AND CONTROLLING ASSAYS AND ASSAY PERFORMANCE. IN THE PRESENT CASE OF 2019-nCoV, VIRUS ISOLATES OR SAMPLES FROM INFECTED PATIENTS HAVE SO FAR NOT BECOME AVAILABLE TO THE INTERNATIONAL PUBLIC HEALTH COMMUNITY. We report here on the establishment and validation of a diagnostic workflow for 2019-nCoV screening and specific confirmation, DESIGNED IN ABSENCE OF AVAILABLE VIRUS ISOLATES OR ORIGINAL PATIENT SPECIMENS. Design and validation were ENABLED BY THE CLOSE GENETIC RELATEDNESS TO THE 2003 SARS-CoV, AND AIDED BY THE USE OF SYNTHETIC NUCLEIC ACID TECHNOLOGY." "Clinical samples and coronavirus cell culture supernatants for initial assay evaluation CELL CULTURE SUPERNATANTS CONTAINING TYPED CORONAVIRUSES AND OTHER RESPIRATORY VIRUSES WERE PROVIDED BY CHARITÉ AND UNIVERSITY OF HONG KONG RESEARCH LABORATORIES. Respiratory samples were obtained during 2019 from patients hospitalised at Charité medical centre and tested by the NxTAG respiratory pathogen panel (Luminex, S´Hertogenbosch, The Netherlands) or in cases of MERS-CoV by the MERS-CoV upE assay as published before [10]. Additional samples were selected from biobanks at the Rijksinstituut voor Volksgezondheid en Milieu (RIVM), Bilthoven, at Erasmus University Medical Center, Rotterdam, at Public Health England (PHE), London, and at the University of Hong Kong. SAMPLES FROM ALL COLLECTIONS COMPRISED SPUTUM AS WELL AS NOSE AND THROAT SWABS WITH OR WITHOUT VIRAL TRANSPORT MEDIUM. FAECAL SAMPLES CONTAINING BAT-DERIVED SARS-related CoV SAMPLES (identified by GenBank accession numbers) WERE TESTED: KC633203, Betacoronavirus BtCoV/Rhi_eur/BB98–98/BGR/2008; KC633204, Betacoronavirus BtCoV/Rhi_eur/BB98–92/BGR/2008; KC633201, Betacoronavirus BtCoV/Rhi_bla/BB98–22/BGR/2008; GU190221 Betacoronavirus Bat coronavirus BR98–19/BGR/2008; GU190222 Betacoronavirus Bat coronavirus BM98–01/BGR/2008; GU190223, Betacoronavirus Bat coronavirus BM98–13/BGR/2008. ALL SYNTHETIC RNA USED IN THIS STUDY was photometrically quantified." "Real-time reverse-transcription PCR A 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribose triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of NONACETYLATED BOVINE SERUM ALBUMIN (Roche). Primer and probe sequences, as well as optimised concentrations are shown in Table 1. ALL OLIGONUCLEOTIDES WERE SYNTHESIZED and provided by Tib-Molbiol (Berlin, Germany). Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and THEN 45 CYCLES of 95 °C for 15 s, 58 °C for 30 s." "The INTENDED CROSS-REACTIVITY OF ALL ASSAYS WITH VIRAL RNA OF SARS-CoV allows us to use the assays WITHOUT HAVING TO RELY ON EXTERNAL SOURCES OF SPECIFIC 2019-nCoV RNA." "RESULTS BEFORE PUBLIC RELEASE OF VIRUS SEQUENCES FROM CASES OF 2019-nCoV, WE RELIED ON SOCIAL MEDIA REPORTS ANNOUNCING DETECTION OF A SARS-LIKE VIRUS. WE THUS ASSUMED THAT A SARS-RELATED CoV IS INVOLVED IN THE OUTBREAK. We downloaded all complete and partial (if > 400 nt) SARS-related virus sequences available in GenBank by 1 January 2020. The list (n = 729 entries) was manually checked and artificial sequences (laboratory-derived, synthetic, etc), as well as sequence duplicates were removed, resulting in a final list of 375 sequences. THESE SEQUENCES WERE ALIGNED AND THE ALIGNMENT WAS USED FOR ASSAY DESIGN (Supplementary Figure S1). UPON RELEASE OF THE FIRST 2019-nCoV SEQUENCE at virological.org, THREE ASSAYS WERE SELECTED BASED ON HOW WELL THEY MATCHED TO THE 2019-nCoV GENOME (Figure 1). The alignment was complemented by additional sequences released independently on GISAID (https://www.gisaid.org), CONFIRMING THE GOOD MATCHING OF SELECTED PRIMERS to all sequences. Alignments of primer binding domains with 2019-nCoV, SARS-CoV as well as selected bat-associated SARS-related CoV are shown in Figure 2." "Assay sensitivity based on SARS coronavirus virions To obtain a preliminary assessment of analytical sensitivity, we USED PURIFIED CELL CULTURE SUPERNATANT CONTAINING SARS-CoV STRAIN FRANKFURT-1 VIRIONS GROWN ON VERO CELLS. The supernatant was ultrafiltered and thereby concentrated from a ca 20-fold volume of cell culture supernatant. THE CONCENTRATION STEP SIMULTANEOUSLY REDUCES THE RELATIVE CONCENTRATION OF BACKGROUND NUCLEIC ACIDS SUCH AS NOT VIRION-PACKAGED VIRAL RNA. The virion preparation was quantified by real-time RT-PCR using a specific in vitro-transcribed RNA quantification standard as described in Drosten et al. [8]." "Discrimination of 2019 novel coronavirus from SARS coronavirus by RdRp assay FOLLOWING THE RATIONALE THAT SARS-CoV RNA CAN BE USED AS A POSITIVE CONTROL FOR THE ENTIRE LABORATORY PROCEDURE, THUS OBVIATING THE NEED TO HANDLE 2019-nCoV RNA, we formulated the RdRp assay so that it contains two probes: a broad-range probe reacting with SARS-CoV and 2019-nCoV and an additional probe that reacts only with 2019-nCoV. By limiting dilution experiments, we confirmed that both probes, whether used individually or in combination, provided the same LOD for each target virus. The specific probe RdRP_SARSr-P2 detected only the 2019-nCoV RNA transcript but not the SARS-CoV RNA.: "TO SHOW THAT THE ASSAYS CAN DETECT OTHER BAT-ASSOCIATED SARS-related VIRUSES, WE USED THE E GENE ASSAY TO TEST SIX BAT-DERIVED FAECAL SAMPLES available from Drexler et al. [13] und Muth et al. [14]. These virus-positive samples stemmed from European rhinolophid bats. DETECTION OF THESE PHYLOGENETIC OUTLIERS within the SARS-related CoV clade SUGGESTS THAT ALL ASIAN VIRUSES ARE LIKELY TO BE DETECTED. This would, theoretically, ensure broad sensitivity even in case of multiple independent acquisitions of variant viruses from an animal reservoir." "Cross-reactivity with other coronaviruses Cell culture supernatants containing all endemic human coronaviruses (HCoV)‑229E, ‑NL63, ‑OC43 and ‑HKU1 as well as MERS-CoV were tested in duplicate in all three assays (Table 2). FOR THE NON-CULTIVABLE HCoV-HKU1, supernatant from human airway culture was used. Viral RNA concentration in all samples was determined by specific real-time RT-PCRs and in vitro-transcribed RNA standards designed for absolute quantification of viral load. Additional undiluted (but not quantified) cell culture supernatants were tested as summarised in Table 2. THESE WERE ADDITIONALLY MIXED INTO NEGATIVE HUMAN SPUTUM SAMPLES. None of the tested viruses or virus preparations showed reactivity with any assay." "TECHNICAL QUALIFICATION DATA BASED ON CELL CULTURE MATERIALS AND SYNTHETIC CONSTRUCTS, as well as results from exclusivity testing on 75 clinical samples, were included in the first version of the diagnostic protocol provided to the WHO on 13 January 2020." https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6988269/... In Summary: -no "viral isolates" were available at the time Drosten created his PCR test -the aim of his study was to develop a test without needing "virus" material -the workflow was based on the "close genetic-relatedness" between "SARS-COV-1" and "SARS-COV-2" (only 79% which is really not close at all) with the use of SYNTHETIC nucleic acid technology -they based assay exclusivity off of 297 clinical samples containing a range of respiratory "viruses" but none with "SARS-COV-2" -the genome sequence supplied by the Chinese SUGGESTED a "virus" related to "SARS-COV-1" -in their previous test developments, "viral isolates" were available as the primary substrate for establishing and controlling assays and assay performance -since no "virus isolates" were available this time around, they decided that the presumed relation to "SARS-COV-1" was enough to develop a reliable test with the use of synthetic nucleic acid technology -cell culture supernatant for different "viruses" were provided by the Charite and various other sources -samples were from sputum as well as nose and throat swabs with or without viral transport media -they also used fecal samples supposedly containing Bat-related "Coronaviruses" -synthetic RNA was used in the study -during RT-PCR, various chemicals were used along with nonacetylated bovine serum albumin -all oligonucleotides were synthesized -the RT-PCR tests were run to 45 Cycles (remember, according to Fauci, anything above 35 is just dead nucleotides) -the intended cross-reactivity of all assays to "SARS-COV-1" somehow meant they did not need any "SARS-COV-2" isolates -they relied on social media reports and assumed from those that a "Coronavirus" related to "SARS-COV-1" was the culprit -numerous different "SARS-COV-1" genomes (375) were aligned and used to design the assays for "SARS-COV-2" -3 assays were chosen based on how well they matched up with the "SARS-COV-2" genome -they used "purified SARS-COV-1" grown on Vero Cells to test analytical sensitivity -they ultrafiltered the cell culture supernatant to REDUCE (not eliminate) the background nucleic acids such as not virion-packaged viral RNA -they "rationalized" (cough assumed cough) that "SARS-COV-1" could act as a positive control for "SARS-COV-2" in all tests -they determined that the E Gene assay can detect ALL ASIAN "VIRUSES -they also admit HCoV-HKU1 is non-cultivable -for some reason, they mixed "viral" culture supernatant with "non-viral" human sputum samples to test vs just using the unaltered human samples -the originally submitted technological qualifications were based on cell culture materials and synthetic constructs -the study itself was peer-reviewed and accepted in less than 24 hours For an in-depth breakdown of this the Drosten PCR fraud, read the Corman-Drosten Review Report: https://m.facebook.com/story.php?story_fbid=10157875675388576&id=502548575 And just in case you thought the CDC was above creating a PCR test without any "virus" available, know you would be wrong. This is from the FDA emergency use authorization of the CDC's PCR test used in the USA: "SINCE NO QUANTIFIED VIRUS ISOLATES OF THE 2019-nCoV ARE CURRENTLY AVAILABLE, assays designed for detection of the 2019-nCoV RNA were tested with characterized stocks of in vitro transcribed full length RNA (N gene; GenBank accession: MN908947.2) of known titer (RNA copies/µL) spiked into a diluent consisting of a SUSPENSION OF HUMAN A549 CELLS AND VIRAL TRANSPORT MEDIUM (VTM) TO MIMIC CLINICAL SPECIMEN." https://www.fda.gov/media/134922/download So it appears there is no need to have "viruses" available to create and validate tests anymore. Drosten and others can get on Twitter, read some social media reports, and then come up with a test for a "novel virus" on their computers without ever needing the actual "virus" present. They can just use the old not-as-closely-related-as-they-would-like-you-to-believe "viruses" as a stand-in. Pretty neat trick with how everything, from the "novel virus" itself to the test to detect it, are all computer-based. Those Virologists sure dodged a bullet with their molecular tricks and consensus computer algorithms as there is no need for the gold standard of a purified/isolated "virus." Social media driven computer-based synthetic creations are all the rage these days. For more information on Christian Drosten's history with fraud: https://m.facebook.com/story.php?story_fbid=10157751025113576&id=502548575 __


Mike Stone document (AMAZING - THWE AMOUNT OF GOOD WORK FROM THIS FELLA )

https://docs.google.com/document/d/e/2PACX-1vQtVav4dmSOSafCDWBdelyXQRx8Y_ACCSz3rqtYw2b5Cs9aEWSxFc70I3b5JmWHEUS8cUrJZxFiXO1x/pub?fbclid=IwAR0AbeKL2e_iMNPhLXwd7Rc2oPknq3IvthSlsWao0n8nSYJHv9ca1k5okBo

____

 
 
 

Recent Posts

See All

Comments


bottom of page